![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 16 of 16 for SREBF1 and MYC. (0.06 seconds) |
Did you mean: SREBP1 and MYC
133 new gene localizations on the rabbit cytogenetic map - Full text - MIT Libraries
C Chantry-Darmon, C Rogel-Gaillard, M Bertaud, C … - Cytogenetic and Genome Research, 2003 - content.karger.com
... MYC AGAGAAGCTGGCCTCCTACC AGTGGGTAGGGGAAGACCAC rabbit AB019241 158 ... SREBF1
ATCCTGGCCACAGTACCACT AACGGTAGCGCTTCTCAATG rabbit AF278696 142 ...
Cited by 1 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
High-resolution mapping of amplifications and deletions in pediatric osteosarcoma by use of CGH …
JA Squire, J Pei, P Marrano, B Beheshti, J Bayani, … - Genes Chromosomes and Cancer, 2003 - doi.wiley.com
... Interestingly, MYC oncogene inactivation was recently shown to result in sus- tained
regression of tumors ... SREBF1 Osteosarcoma cell line Transcription factor ...
Cited by 15 - Web Search - utoronto.ca - ams.sunysb.edu - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Gene expression profile of serial samples of transformed B-cell lymphomas - Full text - MIT Libraries
S de Vos, WK Hofmann, TM Grogan, U Krug, M Schrage … - Lab Invest, 2003 - nature.com
... by vascular endothelial growth factor, CD20, CD22, and c-MYC expression in ... type 8
U08815 SF3A3 Splicing factor 3a, subunit 3 U00968 SREBF1 Sterol regulatory ...
Cited by 12 - View as HTML - Web Search - nature.com - knm1.ibe.med.uni-muenchen.de - ncbi.nlm.nih.gov
Differential transcriptional regulation by human immunodeficiency virus type 1 and gp120 in human …
D Galey, K Becker, N Haughey, A Kalehua, D Taub, J … - J. Neurovirol, 2003 - taylorandfrancis.metapress.com
... Sterol regulatory element–binding transcription factor 1 SREBF1 NM 004176
0 1.631181 Lyphotoxin alpha (TNF superfamily, member 1) ...
Cited by 4 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Novel transcription factors in human CD34 antigen-positive hematopoietic cells - Full text - MIT Libraries
I Gomes, TT Sharma, S Edassery, N Fulton, BG Mar, … - Blood, 2002 - bloodjournal.org
... Hs.7647 MAZ MYC-associated zinc finger protein (purine-binding transcription factor ...
Hs.166 SREBF1 Sterol regulatory element binding transcription factor 1 17p11 ...
Cited by 3 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
Microarray analysis of gene expression in human donor sclera - Full text - MIT Libraries
TL Young, GS Scavello, PC Paluru, JD Choi, EF … - Mol Vis, 2004 - molvis.org
... NM_012323 v-maf musculoaponeurotic MAFF 22q13.1 fibrosarcoma oncogene homolog F
(avian) NM_002383 MYC-associated zinc finger MAZ 16p11.2 protein (purine ...
Cited by 3 - View as HTML - Web Search - molvis.org - scavello.net - ncbi.nlm.nih.gov
The SREBP Pathway: Regulation Review of Cholesterol Metabolism by Proteolysis of a Membrane-Bound … - Full text - MIT Libraries
MS Brown, JL Goldstein - Cell, 1997 - genetics.med.harvard.edu
... Similar se- quences are found in MyoD, Myc, and Max proteins, and in more than a
score of other DNA binding proteins, all of which regulate transcription ...
Cited by 753 - View as HTML - Web Search - vmb.montana.edu - biochem.wisc.edu - utsouthwestern.edu - all 9 versions »
IMMUNOLOGY AND MOLECULAR BIOLOGY Cloning of cDNA Encoding the Nuclear Form of Chicken Sterol …
S Assaf, D Hazard, F Pitel, M Morisson, M Alizadeh … - Poultry Science - poultryscience.org
... V variation) in SREBP-2 helix 1 domain: however, the isoleucine has been observed
in several other bHLH-Zip family members, such as TFE3, USF, c-myc, MAX, or AP ...
View as HTML - Web Search
Hyperphosphorylation regulates the activity of SREBP1 during mitosis
MT Bengoechea-Alonso, T Punga, J Ericsson - pnas.org
... in insulin signaling and during adipocyte differentiation (1). Two genes, srebf1
and srebf2 ... of a number of transcription factors, including p53 and c-Myc, in a ...
Web Search - pnas.org
Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of … - Full text - MIT Libraries
H Shimano, JD Horton, I Shimomura, RE Hammer, MS … - J. Clin. Invest, 1997 - jci.org
... element binding protein-1 (SREBF1) and localization of SREBF1 and SREBF2 ... 1993)Mad:
a heterodimeric partner for Max that antagonizes Myc transcriptional activity ...
Cited by 134 - Web Search - jci.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
QTL analysis and localization of genes involved in the variation of cholesterol levels in the rat
A Bonne - 2002 - library.uu.nl
... Structure of the human gene encoding sterol regulatory element binding protein-1
(SREBF1) and localization of SREBF1 and SREBF2 to chromosomes 17p11.2 and 22q13 ...
View as HTML - Web Search - dspace.library.uu.nl
Relationship between hepatic phenotype and changes in gene expression in cytochrome P450 reductase ( … - Full text - MIT Libraries
XJ WANG, M CHAMBERLAIN, O VASSIEVA, CJ HENDERSON, … - Biochem. J, 2005 - biochemj.org
... element binding factor (SREBP-1 or Srebf1) was decreased 50% in the liver of HRN
mice. It is well established that SREBP-1c, which is the main SREBP-1 isoform ...
View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
New perspectives in the regulation of hepatic glycolytic and lipogenic genes by insulin and glucose: … - Full text - MIT Libraries
F Foufelle, P Ferre - Biochem J, 2002 - bj.portlandpress.com
Page 1. Biochem. J. (2002) 366, 377–391 (Printed in Great Britain) 377 REVIEW
ARTICLE New perspectives in the regulation of hepatic ...
Cited by 45 - View as HTML - Web Search - biochemj.org - dx.doi.org - nutritionandmetabolism.com - all 7 versions »
PROTEOLYSIS AND STEROL REGULATION - Full text - MIT Libraries
RY Hampton - Annual Review of Cell and Developmental Biology, 2002 - cellbio.annualreviews.org
Page 1. Annu. Rev. Cell Dev. Biol. 2002. 18:345–78 doi: 10.1146/annurev.cellbio.
18.032002.131219 Copyright c 2002 by Annual Reviews. ...
Cited by 24 - Web Search - hamptonlab.ucsd.edu - astro.annualreviews.org - ncbi.nlm.nih.gov - all 5 versions »
Transcriptional Changes Underlying the Secretory Activation Phase of Mammary Gland Development
MJ Naylor, SR Oakes, M Gardiner-Garden, J Harris, … - Molecular Endocrinology, 1868 - mend.endojournals.org
... The key transcription factors Srebf1, controlling lipid metabolism genes (45), Cebp ,
involved in lipogenic responses and mammary development (46), and Sox4, a ...
Web Search - mend.endojournals.org - dx.doi.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
The Human Obesity Gene Map: The 2004 Update - Full text - MIT Libraries
L Perusse, T Rankinen, A Zuberi, YC Chagnon, SJ … - Obesity Research, 2005 - obesityresearch.org
... PPARG (123) (124) (125) (126) (127) (128) , PTPN1 (129) (130) PTPRF (131) , RETN
(132) (133) , SGK (134) , SLC6A14 (135) , SORBS1 (121) , SREBF1 (136) , TNF ...
Cited by 2 - Web Search - obesityresearch.org - ncbi.nlm.nih.gov
Did you mean to search for: SREBP1 and MYC
| |
©2005 Google