![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 4 of 4 for SREBF1 and TP53. (0.05 seconds) |
Did you mean: SREBP1 and TP53
High-resolution mapping of amplifications and deletions in pediatric osteosarcoma by use of CGH …
JA Squire, J Pei, P Marrano, B Beheshti, J Bayani, … - Genes Chromosomes and Cancer, 2003 - doi.wiley.com
... SREBF1 Osteosarcoma cell line Transcription factor ... CGH, we identified two OSs with
deletions starting in the region just prox- imal to the TP53 gene and ...
Cited by 15 - Web Search - utoronto.ca - ams.sunysb.edu - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
133 new gene localizations on the rabbit cytogenetic map - Full text - MIT Libraries
C Chantry-Darmon, C Rogel-Gaillard, M Bertaud, C … - Cytogenetic and Genome Research, 2003 - content.karger.com
... TP53 CTGCCAGCTAGCAAAGACCT ACAACTTCCGTCATGTGCTG rabbit X90592 117 NDEL1
GGACTCTGCGCGATATCAAT CTTCTGCATCCAGTGACCAA rabbit AF015037 128 SREBF1 ...
Cited by 1 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
High expression of two genes selected by iAFLP: A new prognostic factor of estrogen receptor- … - Full text - MIT Libraries
N Aritake, Y Tamaki, N Masuda, Y Nakano, T Monden, … - Oncol Rep, 2004 - 147.52.72.117
... PMBP is a receptor for steroids and SREBF1 regulates the transcription of
genes for sterol biosynthesis and the LDL receptor gene. ...
Cited by 1 - View as HTML - Web Search - ncbi.nlm.nih.gov
Aberrant hypermethylation of the major breakpoint cluster region in 17 p 11. 2 in medulloblastomas …
MC Fruehwald, MS O'Dorisio, Z Dai, LJ Rush, R … - Genes Chromosomes and Cancer, 2001 - doi.wiley.com
Page 1. Aberrant Hypermethylation of the Major Breakpoint Cluster Region
in 17p11.2 in Medulloblastomas but not Supratentorial PNETs ...
Cited by 22 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Did you mean to search for: SREBP1 and TP53
|
©2005 Google