![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 42 of 42 for SRF and GATA1. (0.08 seconds) |
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... AML1 CEBP 1263.9 TFC11 TFC11MAFG 154.3 CDPCR1 GATA1 56.1 CEBP SRF 28.3 CDPCR3HD
PBX1 1177.3 FREAC7 GATA1 153.0 CDP GATA1 52.0 P300 SREBP1 27.9 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
In Silico Identification of Regulatory Elements of GRIN 1 Genes
MK Mejia-Guerra, LR Lareo - Omics A Journal of Integrative Biology, 2005 - dx.doi.org
... 500 to 400 E47 c-Ets STATx E12 STATx 400 to 300 AML-1a SRF SRF AML-1a
HFS-2 300 to 200 GATA1 GATA1, GATAX GATA1, GATAX GATA2 GATA2 ...
Web Search - liebertonline.com - liebertonline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Genomic organization and mapping of mouse CDV(carnitine deficiency-associated gene expressed in … - Full text - MIT Libraries
M Higashi, K Kobayashi, M Iijima, S Wakana, M … - Mammalian Genome, 2000 - springerlink.com
... YY1 may compete with SRF at the same site (Chen and Schwartz 1997). The far upstream
sequence of CDV-1 gene contained repetitive GATA1 and STRE (stress re ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
Annotating significant pairs of transcription factor binding sites in regulatory DNA - Full text - MIT Libraries
K Rateitschak, T Mueller, M Vingron - In Silico Biol, 2004 - iospress.metapress.com
... ATF6,MAX 1.7 STAT1,CREB 1.8 PITX2,GNCF 2.0 GABP,GABP 1.7 ELK,GABP 1.8
ARP1,GATA1 1.9 MAX ... 2.3 SRF,SRF 1.4 SP3,TAXCREB 2.2 CJ,ATF6 2.0 ...
Cited by 1 - Web Search - bioinfo.de - bioinfo.de - ncbi.nlm.nih.gov
Transcriptional regulation of cardiac development: implications for congenital heart disease and … - Full text - MIT Libraries
JA Epstein, CA Buck - Pediatr Res, 2000 - pedresearch.org
... GATA1, 2, and 3 are important during hematopoietic development (7, 8), while GATA4,
5, and 6 ... factors such as Nkx2.5 and serum response factor (SRF) to activate ...
Cited by 19 - Web Search - pedresearch.org - ncbi.nlm.nih.gov
REVIEW ARTICLES Transcriptional Regulation of Cardiac Development: Implications for Congenital Heart …
JA EPSTEIN, CA BUCK - PEDIATRIC RESEARCH, 2000 - uphs.upenn.edu
... GATA1, 2, and 3 are important during hematopoietic development (7, 8), while GATA4,
5, and 6 ... factors such as Nkx2.5 and serum response factor (SRF) to activate ...
View as HTML - Web Search - Get it from MIT Libraries
Y. James Kang
BEHP Publications, VS Cart, C Opportunities, REHP … - Environmental Health Perspectives Supplements, 2001 - ehis.niehs.nih.gov
... Thus, activation of SRF may be the general mechanism of c-fos activation in response
to ... They are GATA1, 2, 3, 4, 5, and 6. Each protein contains two similar ...
Cached - Web Search - ehp.niehs.nih.gov - ehpnet1.niehs.nih.gov - ehis.niehs.nih.gov - all 6 versions » - Get it from MIT Libraries
Molecular and Cellular Mechanisms of Cardiotoxicity - Full text - MIT Libraries
M Responses - Environmental Health Perspectives, 2001 - ehp.niehs.nih.gov
... Thus, activation of SRF may be the general mechanism of c-fos activation in response
to ... They are GATA1, 2, 3, 4, 5, and 6. Each protein contains two similar ...
View as HTML - Web Search - ehpnet1.niehs.nih.gov - ehis.niehs.nih.gov
SUMO-1 Modification Activated GATA 4-dependent Cardiogenic Gene Activity - Full text - MIT Libraries
J Wang, X Feng, RJ Schwartz - J Biol Chem, 2004 - jbc.org
... did not appear to have any significant effect on GATA1 function, our ... least another
cardiac-enriched transcription factor, serum response factor (SRF), which is ...
Web Search - jbc.org - ncbi.nlm.nih.gov
Combinatorial Expression of GATA 4, Nkx 2-5, and Serum Response Factor Directs Early Cardiac Gene … - Full text - MIT Libraries
JL Sepulveda, S Vlahopoulos, D Iyer, N Belaguli, … - J Biol Chem, 2002 - jbc.org
... Sp1 has been reported to physically interact with GATA1 (27-29), Nkx2-1 (30), and
MEF2C (31) and to functionally interact with SRF to regulate the CA promoter ...
Cited by 36 - Web Search - jbc.org - ncbi.nlm.nih.gov
Oncogenes et leucemies: historique et perspectives
S Gisselbrecht, BG Roussy - M e decine et Science, 2003 - erudit.org
... LIM: motif riche en cystéines; SRF: serum responsive factor; PDGF: platelet-derived ...
Ces leucémies présentent des mutations ponctuelles du gène GATA1. ...
Cited by 2 - Cached - Web Search
Ternary Complex Formation between MADS-box Transcription Factors and the Histone Fold Protein NF-YB - Full text - MIT Libraries
S Masiero, C Imbriano, F Ravasio, R Favaro, N … - J Biol Chem, 2002 - jbc.org
... On the other hand the human MADS-box protein SRF, which activates numerous growth
factor ... incubated at 4 °C with anti-NF-YA or control anti-GATA1 antibodies (5 ...
Cited by 10 - Web Search - jbc.org - ncbi.nlm.nih.gov
Regulatory Sequence Analysis of Coclustering Genes
A TFBS - ahavj.ahajournals.org
... GATA1, 14/52=27, 11/29=38, 4/11=36, 3/6=50, 6/16=38, 2/3=67, 1/4=25, 2/9=22,
0/1=0, 1/1=100. ... SRF, 4/52=8, 1/29=3, 0/11=0, 2/6=33, 4/16=25, 0/3=0, 0/4=0, 0/9=0, ...
Web Search
acquises de la cellule souche hematopoietique ou d’un precurseur deja commis vers les lignees …
S YNTHESE - MEDECINE/SCIENCES, 2003 - ist.inserm.fr
... aiguës mégacaryocytiques de l’enfant MAL (22q13) Co-activateur du facteur SRF
t(16;21 ... Ces leucémies présentent des mutations ponctuelles du gène GATA1. ...
View as HTML - Web Search - erudit.org
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... RCCAA SRF 01 Serum response factor Core should be CCATATATGG not TATA ... GATAA
GATA1 06 GATA-binding factor 1 Core should be GATAA not GATA ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Zinc® nger proteins: watchdogs in muscle development - Full text - MIT Libraries
A Krempler, B Brenig - Mol Gen Genet, 1999 - springerlink.com
... Skeletal Muscle LIM Protein (SLIM) 4 LIM domains 1 GATA1-like zinc ®nger ... of the skeletal
a-actin gene by excluding Serum Response Factor (SRF), a positive MADS ...
Cited by 12 - Web Search - springerlink.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
GATA-4 and Nkx-2.5 coactivate Nkx-2 DNA binding targets: role for regulating early cardiac gene … - Full text - MIT Libraries
JL Sepulveda, N Belaguli, V Nigam, CY Chen, M … - Mol. Cell. Biol, 1998 - mcb.asm.org
... The cardiogenic homeodomain factor Nkx-2.5 and serum response factor (SRF) provide
strong transcriptional coactivation of the cardiac -actin ( CA) promoter in ...
Cited by 130 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
A calcineurin-dependent transcriptional pathway for cardiac hypertrophy - Full text - MIT Libraries
JD Molkentin, JR Lu, CL Antos, B Markham, J … - Cell, 1998 - unb.br
... failure. ing sites for several transcription factors, including se- rum response
factor (SRF), TEF-1, AP-1, and Sp1, are Introduction ...
Cited by 596 - View as HTML - Web Search - ncbi.nlm.nih.gov
GATA6 Is Essential for Embryonic Development of the Liver but Dispensable for Early Heart Formation - Full text - MIT Libraries
R Zhao, AJ Watt, J Li, J Luebke-Wheeler, EE … - Mol Cell Biol, 2005 - mcb.asm.org
... GATA1, -2, and -3 appear to act primarily in ... TCTTTCTTCCTCTTCTCCTC; Nkx2-5,
CGCCGCCTCCGCCAACAGCAACT and GGGCGACGGCAAGACAACCAG; Srf, AGATCCCTGTCTCTGCAGTTCAGC ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
Transcriptional regulation of the cardiac-specific MLC2 gene during Xenopus embryonic development - Full text - MIT Libraries
X XMLC - Development - dev.biologists.org
... patterns, the GATA proteins have been divided into two subfamilies: GATA1/2/3 ... SRF
is involved in regulation of muscle-specific and growth factor-inducible ...
Cited by 4 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The Transcription Factors GATA 4 and GATA 6 Regulate Cardiomyocyte Hypertrophy in Vitro and in Vivo - Full text - MIT Libraries
Q Liang, LJ De Windt, SA Witt, TR Kimball, BE … - J Biol Chem, 2001 - jbc.org
... binding activity of the closely related transcription factor GATA1 is directly ... with
other cardiac-expressed transcription factors such as SRF, myocyte enhancer ...
Cited by 43 - Web Search - jbc.org - ncbi.nlm.nih.gov
Regulatory Factors Involved in Cardiogenesis
B Zheng, JK Wen, M Han - BIOCHEMISTRY (Moscow), 2003 - springerlink.com
... other cardiacrestricted factors, such as GATA4 and serum response factor (SRF)
[6]. However ... GATA proteins have been divided into two subfami lies, GATA1, 2, and ...
Cited by 1 - Web Search - kluweronline.com - ncbi.nlm.nih.gov - maik.ru - all 5 versions » - Get it from MIT Libraries
A newly discovered human {alpha}-globin gene - Full text - MIT Libraries
SH Goh, YT Lee, NV Bhanu, MC Cam, R Desper, BM … - Blood, 2005 - bloodjournal.org
... activator protein 2; EKLF, erythroid Kruppel-like factor; GATA1, GATA binding ... protein
1; NRSE, neural restrictive silencer element; and SRF, serum response ...
Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Modulation of Smooth Muscle Gene Expression by Association of Histone Acetyltransferases and … - Full text - MIT Libraries
D Cao, Z Wang, CL Zhang, J Oh, W Xing, S Li, JA … - Mol Cell Biol, 2005 - mcb.asm.org
... it selectively activates smooth muscle target genes by bridging SRF bound at ... domain
CH3, which mediates the interaction between p300 and GATA1, GATA4, MyoD, E1A ...
Cited by 3 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Molecular cloning of the mouse gene coding for carbonic anhydrase IV
S Tamai, LB Cody, WS Sly - Biochem. Genet, 1996 - springerlink.com
... putative binding sites for Spl (-209), NF-KB (-292, -368), AP1 (-364), GATA1 (-348,
-374 ... The binding motifs of CAAT, C/EBP, AP2, octamer, CREB, and SRF were not ...
Cited by 7 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
PAINT: A Promoter Analysis and Interaction Network Generation Tool for Gene Regulatory Network …
R Vadigepalli, P Chakravarthula, DE Zak, JS … - Omics A Journal of Integrative Biology, 2003 - dx.doi.org
... V$GATA/GATA1.04 0.061552 0.44073 0.028036 V$GATA/GATA1.05 0.37167 0.85809 0.057487 ...
V$SRFF/SRF.01 0.11762 0.28177 0.14787 V$TBPF/TATA.02 0.12603 0.1321 0.41078 ...
Cited by 4 - Web Search - liebertonline.com - che.udel.edu - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Transcription factors as targets for DNA-interacting drugs
M Gniazdowski, WA Denny, SM Nelson, M Czyz - Curr. Med. Chem, 2003 - ingentaconnect.com
Page 1. Current Medicinal Chemistry, 2003, 10, 909-924 909 0929-8673/03
$41.00+.00 © 2003 Bentham Science Publishers Ltd. Transcription ...
Cited by 6 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Vertebrate homologs of tinman and bagpipe: Roles of the homeobox genes in cardiovascular development
M Tanaka, H Kasahara, S Bartunkova, M Schinke, I … - Developmental Genetics, 1998 - doi.wiley.com
... SRF) can recruit Csx/Nkx2.5 to the serum response element and that SRF and Csx ... Of
the six GATA genes identified in vertebrates, GATA1, 2, and 3 are expressed in ...
Cited by 29 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Investigating the origins of triploblasty:mesodermal' gene expression in a diploblastic animal, the … - Full text - MIT Libraries
MQ Martindale, K Pang, JR Finnerty - Development, 2004 - dev.biologists.org
... places Nv-GATA squarely in a clade of GATA genes, including GATA1, GATA2 and ... MADS
domain of various mef2 genes plus blistered and serum response factor (SRF). ...
Cited by 8 - Web Search - faculty.virginia.edu - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Novel transcription factors in human CD34 antigen-positive hematopoietic cells - Full text - MIT Libraries
I Gomes, TT Sharma, S Edassery, N Fulton, BG Mar, … - Blood, 2002 - bloodjournal.org
... GATA1 and GATA2 are down-regulated. ... Hs.155321 SRF Serum response factor (c-fos serum
response element- binding transcription factor) 6pter-p24.1 15.1 I W ...
Cited by 3 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
The LIM domain: regulation by association - Full text - MIT Libraries
I Bach - Mech. Dev, 2000 - bio.kaist.ac.kr
... Furthermore, Lmk1 is able to activate the serum response factor (SRF), a transcription
factor that regulates the expression of many serum-inducible and muscle ...
Cited by 150 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
TranSignal TM Protein/DNA Arrays
PU Manual, MA MA1014 - panomics.com
Page 1. TranSignal TM Protein/DNA Arrays Cat. # MA1010, MA1011, MA1012 Product User
Manual, MA1013 & MA1014, MA1015 Released 09/28/04 Panomics, Inc. ...
View as HTML - Web Search - biocat.de
Multiple Sp1 Binding Sites in the Cardiac/Slow Twitch Muscle Sarcoplamsic Reticulum Ca-ATPase Gene … - Full text - MIT Libraries
DL Baker, V Dave, T Reed, M Periasamy - Mol. Cell. Biol, 2004 - intl.jbc.org
... Known consensus elements for Sp1, Ap2, E-box, CarG, MCAT, and GATA1 are indicated ...
gene has been shown to require Sp1 in addition to MyoD1 and an SRF-like factor ...
Cited by 1 - Web Search - intl.jbc.org
Characterization of the Chicken CTCF Genomic Locus, and Initial Study of the Cell Cycle-regulated … - Full text - MIT Libraries
EM Klenova, S Fagerlie, GN Filippova, L Kretzner, … - J Biol Chem, 1998 - jbc.org
... sequences for NF- B, GATA family, NF-1, NF-Y, Myb, Ap1, Ap2, SRF, Octa family ... in
a separate exon (for example, four fingers in WT1 gene (51), GATA1 and GATA3 ...
Cited by 11 - Web Search - jbc.org - ncbi.nlm.nih.gov
Abstracts of NAVBO Workshop on Vascular Development (Asilomar)
DOFCS MUSCLE, MAOF ENDOTHELIAL - Endothelium, 2003 - taylorandfrancis.metapress.com
Page 1. Endothelium, 10:337–374, 2003 Copyright c Taylor & Francis Inc. ISSN:
1062-3329 print / 1029-2373 online DOI: 10.1080/10623320390272343 ...
Web Search
Modulation of endogenous GATA-4 activity reveals its dual contribution to Mullerian inhibiting … - Full text - MIT Libraries
JJ Tremblay, NM Robert, RS Viger - Mol Endocrinol, 2001 - mend.endojournals.org
Endocrine Society Molecular Endocrinology NCI RAPID Program Address
change for NEW manuscripts November 1st 2003 ...
Cited by 24 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
Abstracts: Vascular Biology, XIIth International Vascular Biology Meeting, 12–16 May, 2002, …
FOF EPITHELIUM, E IN, M ORGANISMS - Endothelium, 2002 - dx.doi.org
... Hhex and Scl can induce the expression of the endothelial gene flk1 as well as the
erythroid gene gata1, suggesting that they positively regu- late the ...
Web Search
Abstracts: Vascular Biology, XIIth International Vascular Biology Meeting, 12–16 May, 2002, …
FOF EPITHELIUM, E IN, M ORGANISMS - Endothelium, 2002 - taylorandfrancis.metapress.com
... Hhex and Scl can induce the expression of the endothelial gene flk1 as well as the
erythroid gene gata1, suggesting that they positively regu- late the ...
Web Search
SIGNALING PATHWAYS IN MYOCYTE HYPERTROPHY
B Oulu - herkules.oulu.fi
... polymerase chain reaction SAPK stress-activated protein kinase SD Sprague-Dawley
SEM standard error of mean SRE serum response element SRF serum response ...
View as HTML - Web Search
Combinatorial interactions regulating cardiac transcription
D Durocher, M Nemer - Developmental Genetics, 1998 - doi.wiley.com
... Interestingly, the conserved AT-rich region located between the GATA and NKE motifs
has been shown to bind MADS box proteins such as SRF [Sprenkle et al., 1995 ...
Cited by 43 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
The granulocytic inducer C/EBP a inactivates the myeloid master regulator PU. 1: possible role in …
AMK und Poliklinik, III am Klinikum Grosshadern - edoc.ub.uni-muenchen.de
... regulators. The various factors known, so far, to interact are PU.1 interacting
protein (Pip), NF-IL6 (C/EBPd), c-Jun, TBP, RB, GATA1 and CBP 115-117 , 107 . ...
View as HTML - Web Search
TranSignal TM Protein/DNA Arrays
CS Version - panomics.com
Page 1. TranSignal TM Protein/DNA Arrays (Column Separation Version) Cat. #
MA1210, MA1211, MA1212l, MA1213 & MA1214, MA1215 Product ...
View as HTML - Web Search
|
©2005 Google