![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 26 of 26 for SRF and HAND1. (0.06 seconds) |
Embryonic expression of anNkx 2-5/Cre gene usingROSA 26 reporter mice - Full text - MIT Libraries
KA Moses, F DeMayo, RM Braun, JL Reecy, RJ … - genesis, 2001 - doi.wiley.com
... formation of mesoderm, which prevents our ability to ask how SRF functions in ...
downregulated in the absence of Nkx2-5, including CARP, eHand/Hand1, and MLC2V ...
Cited by 5 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis - Full text - MIT Libraries
Y Zhao, E Samal, D Srivastava - Nature, 2005 - nature.com
... G., Zaromytidou, AI & Treisman, R. Actin dynamics control SRF activity by ... mesodermal
defects in mouse embryos lacking the bHLH transcription factor Hand1. ...
Web Search - nature.com - ncbi.nlm.nih.gov
Table 1. Transcription Factors Known or Likely to be Involved in Regulation of SMC Differentiation/ …
T Factor, MB Proteins, H Proteins, SMC Barx2b, KZF … - ahavj.ahajournals.org
... MADS Box Proteins, SRF, numerous SMC differentiation markers 4,6. ... dHAND/HAND2, SMC
specific targets unknown 115. eHAND/HAND1, SMC specific targets unknown 116. ...
Web Search
Transcriptional regulation of vertebrate cardiac morphogenesis - Full text - MIT Libraries
BG Bruneau - Circ. Res, 2002 - circres.ahajournals.org
... of several cardiac gene promoters via serum response factor (SRF)-binding sites ... roles
of the bHLH transcription factors dHand (Hand2) and eHand (Hand1) and the ...
Cited by 44 - Web Search - cardiogene.org - tagc.univ-mrs.fr - dx.doi.org - all 9 versions »
Combinatorial Interactions Regulate Cardiac Expression of the Murine Adenylosuccinate Synthetase 1 … - Full text - MIT Libraries
AL Lewis, Y Xia, SK Datta, J McMillin, RE Kellems - J Biol Chem, 1999 - jbc.org
... been identified (Nkx 2.5 and GATA 4 (27, 45); Nkx 2.5 and SRF (43); MEF2 ... one of the
first reported potential targets of the cardiac bHLH factors Hand1 and Hand2 ...
Cited by 7 - Web Search - jbc.org - ncbi.nlm.nih.gov
Electrical Stimulation of Neonatal Cardiac Myocytes Activates the NFAT 3 and GATA 4 Pathways and Up- … - Full text - MIT Libraries
Y Xia, JB McMillin, A Lewis, M Moore, WG Zhu, RS … - J Biol Chem, 2000 - jbc.org
... at the times indicated, and the abundance of Gata4 and Hand1 mRNA was ... MEF2 proteins
are members of the MCM1, agamous, deficiens, SRF (MADS) family of ...
Cited by 43 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Roles of cardiac transcription factors in cardiac hypertrophy - Full text - MIT Libraries
H Akazawa, I Komuro - Circ Res, 2003 - circres.ahajournals.org
... with other transcription factors such as GATA4, 50–52,134 SRF, 124 T-box–containing
transcription factor Tbx5, 127,135 Tbx2, 136 and eHAND/HAND1. ...
Cited by 14 - Web Search - ahavj.ahajournals.org - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
GATA6 Is Essential for Embryonic Development of the Liver but Dispensable for Early Heart Formation - Full text - MIT Libraries
R Zhao, AJ Watt, J Li, J Luebke-Wheeler, EE … - Mol Cell Biol, 2005 - mcb.asm.org
... TGGCCGACGTGGGAGCAT and CGGCGGGAAGCGGACAG; Hand1, AACCTCAACCCCAAAAGCC and ...
CGCCGCCTCCGCCAACAGCAACT and GGGCGACGGCAAGACAACCAG; Srf, AGATCCCTGTCTCTGCAGTTCAGC ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
Homeodomain Factor Nkx 2-5 in Heart Development and Disease
RP HARVEY, D LAI, D ELLIOTT, C BIBEN, M SOLLOWAY, … - Cold Spring Harbor Symposia on Quantitative Biology, 2002 - dx.doi.org
... Nkx2-5-interacting factors include SRF, GATA4, and Tbx5 (Chen and Schwartz ... cardiac
genes, including those encoding the transcription factors Hand1, Irx4, CITED1 ...
Cited by 8 - Web Search - cshl-symposium.org - cshl-symposium.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
The cardiac homeobox gene Csx/Nkx2. 5 lies genetically upstream of multiple genes essential for … - Full text - MIT Libraries
CT Basson, W Pease, GM Silberbach, JP Moak, M … - Development, 1999 - dev.biologists.org
... Probes for HAND1 (eHAND) (Srivastava et al., 1997), HAND2 (dHAND) (Srivastava et
al., 1997), GATA4 (Molkentin et al., 1997 ... Sp, SpeI; Xb, XbaI; N, NotI; Srf, SrfI ...
Cited by 102 - Web Search - cardiogenomics.med.harvard.edu - cardiogenomics.med.harvard.edu - ncbi.nlm.nih.gov - all 6 versions »
A decade of discoveries in cardiac biology - Full text - MIT Libraries
G Access, N Immunology, N Genetics, D Discovery, H … - Nature Medicine, 2004 - nature.com
... Similarly, serum response factor (SRF), a related MADS-box factor, associates ...
chamber-restricted basic helix-loop-helix transcription factors, HAND1 and HAND2 ...
Web Search - nature.com
The transcription factors GATA4 and dHAND physically interact to synergistically activate cardiac … - Full text - MIT Libraries
YS Dai, P Cserjesi, BE Markham, JD Molkentin - J. Biol. Chem, 2002 - jbc.org
... with the MADS box-containing transcription factor serum response factor (SRF), which
together ... with dHAND on the ANF promoter, whereas eHAND (HAND1) did not ...
Cited by 35 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Inhibition of Rho family GTPases by Rho GDP dissociation inhibitor disrupts cardiac morphogenesis … - Full text - MIT Libraries
L Wei, K Imanaka-Yoshida, L Wang, S Zhan, MD … - Development, 2002 - dev.biologists.org
... 5'-TACAGTATGGCCCTGTCCTA-3', reverse 5'-TCCAGGGCCCAGACGTGCTG-3'; eHAND (Hand1; 23
to ... 5'-TTGGCGTCGGGGACTTGAAC-3', reverse 5'-AGGCTACGTCAATAAAGTGG-3'; Srf (22 to ...
Cited by 14 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Sizing up the heart: development redux in disease - Full text - MIT Libraries
EN Olson, MD Schneider - Genes & Development, 2003 - wwwpathnet.medsch.ucla.edu
... Given the right combination of SRF, bridging factors, and tis- sue ... mouse embryogenesis,
the basic helix–loop– helix transcription factors, HAND1 and HAND2 ...
Cited by 31 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
La regionalisation de l’expression de genes cardiaques: implications pour la morphogenese du coeur
RG Kelly, E Buckingham - medecine/sciences, 1998 - ist.inserm.fr
... Nkx, deux facteurs à motif bHLH, eHAND (Hand1) et dHAND (Hand2) (m/s n°6-7,
vol.14, p.802), les protéines qui renferment une boîte MADS dont SRF et les ...
View as HTML - Web Search
Heart development: molecular insights into cardiac specification and early morphogenesis - Full text - MIT Libraries
T Brand - Developmental Biology, 2003 - cb207.med.harvard.edu
... Serum response factor Serum response factor (SRF) is a member of the MADS-
box family to which the MEF2 genes also belong. SRF mediates ...
Cited by 23 - View as HTML - Web Search - cb207.med.harvard.edu - ingentaconnect.com - ncbi.nlm.nih.gov
Fibroblast Growth Factor Plays a Critical Role in SM22 {alpha} Expression During Xenopus … - Full text - MIT Libraries
T Oka, I Shiojima, K Monzen, S Kudoh, Y Hiroi, K … - Arteriosclerosis, Thrombosis, and Vascular Biology, 2000 - atvb.ahajournals.org
... 50 51 Several transcription factors, including SRF and MEF2 family members, have ...
The Hand1 bHLH transcription factor is essential for placentation and cardiac ...
Cited by 1 - Web Search - intl-atvb.ahajournals.org - ahavj.ahajournals.org - ncbi.nlm.nih.gov - all 6 versions »
Direct Activation of a GATA 6 Cardiac Enhancer by Nkx 2. 5: Evidence for a Reinforcing Regulatory … - Full text - MIT Libraries
J Molkentin, C Antos, B Mercer, T Taigen, JM Miano … - Developmental Biology, 2000 - mphywww.tamu.edu
... other potential cardiac transcription factors, in- cluding MEF2C, MEF2B, SRF, eHAND,
dHAND ... defects in mouse embryos lacking the bHLH transcription factor Hand1. ...
Cited by 25 - Web Search - mphywww.tamu.edu - ncbi.nlm.nih.gov - all 4 versions »
Developmental growth of the heart - Full text - MIT Libraries
EN Olson, MD Schneider - GENES & DEVELOPMENT, 2003 - dx.doi.org
... Given the right combination of SRF, bridging factors, and tissue-specific ... embryogenesis,
the basic helix–loop–helix transcription factors, HAND1 and HAND2 ...
Cited by 4 - Web Search - genesdev.org - genesdev.org - genesdev.org
Expression of Fgfr2 in the early mouse embryo indicates its involvement in preimplantation … - Full text - MIT Libraries
R Haffner-Krausz, M Gorivodsky, Y Chen, P Lonai - Mech. Dev, 1999 - weizmann.ac.il
... The Hand1 bHLH tran- scription factor is essential for placentation and cardiac
morphogenesis. ... Twigg, SRF, Oldridge, M., Heath, JK, Wilkie, AOM, 1998. ...
Cited by 21 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
GATA factors and transcriptional regulation of cardiac natriuretic peptide genes.
R Temsah, M Nemer - Regulatory Peptides, 2005 - ircm.qc.ca
... In addition to these factors, ANP transcription is also regulated by the MADS box
proteins, MEF2 and serum response factor (SRF) which play important roles in ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Requirement of the MADS-box transcription factor MEF2C for vascular development - Full text - MIT Libraries
Q Lin, J Lu, H Yanagisawa, R Webb, GE Lyons, JA … - Development, 1998 - dev.biologists.org
... Alternatively, MEF2C could regulate the expression or activity of another factor
(SRF perhaps?) that is essential for SM22 transcription. ...
Cited by 81 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Cardiac chamber formation: development, genes and evolution - Full text - MIT Libraries
AFM Moorman, VM Christoffels - Physiol Rev, 2003 - intl-physrev.physiology.org
Institution: Google Indexer Sign In as Member/Non-Member. Physiol. Rev. 83:
1223-1267, 2003; 10.1152/physrev.00006.2003 0031-9333/03 $15.00 ...
Cited by 24 - Web Search - intl-physrev.physiology.org - ncbi.nlm.nih.gov
Puesta al dia. Genetica y biologia molecular en cardiologia (X). Febrero 2002. Numero 02-Volumen 55 …
D Franco, J Dominguez, MP de Castro, A Aranega - Rev Esp Cardiol, 2002 - revespcardiol.org
... Otros factores de transcripción que se expresan homogéneamente en las crestas
precardíacas son Tbx-5, SRF (serum response factor), CARP (cardiac ankyrin ...
Cached - Web Search - revespcardiol.org
Regulacion de la expresion genica en el miocardio durante el desarrollo cardiaco
D Franco, J Dominguez, MP De Castro, A Aranega - Rev Esp Cardiol, 2002 - revespcardiol.org
... Otros factores de transcripción que se expresan homogéneamente en las crestas
precardíacas son Tbx-5, SRF (serum response factor), CARP (cardiac ankyrin ...
Cited by 2 - Cached - Web Search - revespcardiol.org
Proof of genetic heterogeneity in cardiac septal defects and in heterotaxy
F de Medecine - edoc.bib.ucl.ac.be
... derivative expressed transcripts 1 or 2 (HAND1, HAND2), T-box transcription factors
(TBX5, TBX20), serum response factor (SRF) and myocardin. Combinatorial ...
View as HTML - Web Search
| |
©2005 Google