![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 12 of 12 for SRY and HOXA5. (0.20 seconds) |
Molecular mechanisms of early gut organogenesis: A primer on development of the digestive tract - Full text - MIT Libraries
JC Kiefer - Developmental Dynamics, 2003 - doi.wiley.com
... Sox17 (Sry-related HMG box fac- tor) has recently emerged as an ad ... Moreover, endodermal
Hoxa5 loss-of-function results in a possible rostral homeotic shift of ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genes expressed in the developing endocrine pancreas and their importance for stem cell and diabetes …
JM Wells - Diabetes/Metabolism Research and Reviews, 2003 - doi.wiley.com
... M60523) Foxa2, 3 Forkhead box A2, A3 (NM 010446, MN 008260) Hoxa5, b5 Homeobox ... Pre
B-cell leukemia transcription factor 3 (NM 016768) Sox11 SRY-box containing ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Development of a murine hematopoietic progenitor complementary DNA microarray using a subtracted … - Full text - MIT Libraries
X Ma, T Husain, H Peng, S Lin, O Mironenko, N Maun … - Blood, 2002 - bloodjournal.org
... 1.2 0.4 2.0 0.05 Hmga1 High-mobility group AT-hook 1 — — Hoxa5 Homeobox A5 — — ...
2.1 1.1 2.7 0.26 Sox5 SRY-box containing gene 5 — 3.1 0.22 ...
Cited by 6 - Web Search - info.med.yale.edu - dx.doi.org - ncbi.nlm.nih.gov - all 8 versions »
Hoxb 3 vagal neural crest-specific enhancer element for controlling enteric nervous system … - Full text - MIT Libraries
KK Chan, YS Chen, TO Yau, M Fu, VCH Lui, PKH Tam, … - Developmental Dynamics, 2005 - doi.wiley.com
... In a Hoxa5 knockout mouse mutant, there was evidence that Hoxa5 expression in the
gut mesoderm was important for the specification of overlying gut endoderm. ...
Web Search - ncbi.nlm.nih.gov
Design Principle of Gene Expression Used by Human Stem Cells; Implication for Pluripotency
R Title - arxiv.org
Page 1. Design Principle of Gene Expression Used by Human Stem Cells;
Implication for Pluripotency Michal Golan-Mashiach 1,2* , Jean ...
View as HTML - Web Search - weizmann.ac.il - weizmann.ac.il
How to make an egg: transcriptional regulation in oocytes - Full text - MIT Libraries
JL Song, GM Wessel - Differentiation, 2005 - blackwell-synergy.com
Full Article. View/Print PDF article (1191K). Download to reference manager.
Differentiation Volume 73 Issue 1 Page 1 - February 2005 ...
Web Search - ncbi.nlm.nih.gov
The molecular evolution of development - Full text - MIT Libraries
MD Purugganan - BioEssays, 1998 - doi.wiley.com
... ceh-15, mab-5 HoxA4, HoxB4,HoxC4, HoxD4 Drosophila Dfd HoxA5, HoxB5, HoxC5 ... may have
adaptive significance; for example, rapid evolution of the SRY mamma- lian ...
Cited by 42 - Web Search - purugganan.gnets.ncsu.edu - ncsu.edu - ncbi.nlm.nih.gov - all 5 versions »
SOX 9 specifies the pyloric sphincter epithelium through mesenchymal-epithelial signals - Full text - MIT Libraries
B Moniot, S Biau, S Faure, CM Nielsen, P Berta, DJ … - Development, 2004 - dev.biologists.org
... Stomach regional specification requires Hoxa5-driven mesenchymal-epithelial signaling. ...
Mutations in SRY and SOX9: testis-determining genes. Hum. Mutat. ...
Cited by 2 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Differential Profiles of Genes Expressed in Neonatal Brain of 129X1/SvJ and C57BL/6J Mice: A … - Full text - MIT Libraries
Y Suzuki, M Nakayama - DNA Research, 2003 - dna-res.kazusa.or.jp
... The sex of each newborn mouse was determined via PCR amplifica- tion using primers
(ATACAGAGATCAGCAAGCAGC, GTGTGCAGCTCTACTCCAGTC) for the mouse SRY gene (Y ...
View as HTML - Web Search - dna-res.kazusa.or.jp - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Large-scale reprogramming of cranial neural crest gene expression by retinoic acid exposure - Full text - MIT Libraries
SS Williams, JP Mear, HC Liang, SS Potter, BJ … - Physiological Genomics, 2004 - physiolgenomics.physiology.org
... These include Cyp26a1, Hoxa5, and Meox1 (Fig. 4A). ... The expression of two members
each of the SRY-box (Sox2 and Sox11) and distal-less homeobox (Dlx1 and Dlx5 ...
Cited by 1 - Web Search - physiolgenomics.physiology.org - ncbi.nlm.nih.gov
Anterior–posterior patterning within the Caenorhabditis elegans endoderm - Full text - MIT Libraries
DF Schroeder, JD McGhee - Development, 1998 - dev.biologists.org
... In vertebrates, a number of Hox genes are expressed in endoderm (Duluc et al., 1997;
Walters et al., 1997) and two Hox knock- outs (Hoxa5 and Hoxa3) have been ...
Cited by 10 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
EVOLUTION OF COMPONENTS OF GENE REGULATION IN DROSOPHILA AND MAMMALS
ET Dermitzakis - etda.libraries.psu.edu
Page 1. The Pennsylvania State University The Graduate School The Eberly College
of Science EVOLUTION OF COMPONENTS OF GENE REGULATION IN DROSOPHILA AND MAMMALS ...
View as HTML - Web Search
| |
©2005 Google