![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 73 for STAT3 and AHR. (0.16 seconds) |
Identification of the Cytoplasmic Domains of CXCR 4 Involved in Jak 2 and STAT 3 Phosphorylation - Full text - MIT Libraries
B Ahr, M Denizot, V Robert-Hebmann, A Brelot, M … - J Biol Chem, 2005 - jbc.org
... Identification of the Cytoplasmic Domains of CXCR4 Involved in Jak2 and STAT3
Phosphorylation *. Barbara Ahr §¶ , Mélanie Denizot § , Véronique Robert ...
Web Search - jbc.org - ncbi.nlm.nih.gov
G-protein-independent Activation of Tyk2 by the Platelet-activating Factor Receptor - Full text - MIT Libraries
… D Fourmy, M Dufresne, C Seva, B Ahr, M Denizot, V … - J. Biol. Chem, 2001 - jbc.org
... page B. Ahr, M. Denizot, V. Robert-Hebmann, A. Brelot, and M. Biard-Piechaczyk
Identification of the Cytoplasmic Domains of CXCR4 Involved in Jak2 and STAT3 ...
Web Search
The anti-inflammatory effects of interleukin-10 in allergic disease - Full text - MIT Libraries
EA Tournoy… - Clinical and Experimental Allergy, 2000 - ingentaconnect.com
... which inter- act through Jak1 and Tyk2 tyrosine kinases with Stat1, Stat3 and Stat5
[12 ... and failed to detect a signi®cant increase of antigen-induced AHR in IL ...
Web Search
GEArray Q series Mouse cAMP/Ca2+ PathwayFinder Gene Array: AR-SAMM-028
FG Grouping - eurogentec.com
... Transcription: Atf3, Creb1, Crem, Egr1, Egr2, Fos, Jund1, Maf2-Ests, Nr4a2 (Nur77),
Per1, Pit1, Pou2af1 (OCA- B), Stat3 Metabolic: Ahr, Amd1, Eno2, Hk2, Ldh1 ...
View as HTML - Web Search - eurogentec.be
GEArray Q series Human cAMP/Ca2+ PathwayFinder Gene Array: AR-SAHS-028
FG Grouping - eurogentec.com
... Transcription: ATF3, CREB1, CREM, EGR1, EGR2, FOS, JUND, MAF, NR4A2 (Nur77), PER1,
POU1F1 (Pit-1), POU2AF1 (OCA-B), STAT3 Metabolic: AHR, AMD1, ENO2, HK2, LDHA ...
View as HTML - Web Search - eurogentec.be
beta-Naphthoflavone disturbs astrocytic differentiation of C 6 glioma cells by inhibiting autocrine … - Full text - MIT Libraries
H Takanaga, T Yoshitake, E Yatabe, S Hara, M … - Journal of Neurochemistry, 2004 - blackwell-synergy.com
... appears to play an additional role in the regulation of STAT3 DNA-binding ... flavonoid
compound used routinely in many laboratories as a typical AhR agonist. ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
The Biology of Tobacco and Nicotine: Bench to Bedside - Full text - MIT Libraries
PA Dennis, C Van Waes, JS Gutkind, KJ Kellar, C … - Cancer Epidemiology Biomarkers & Prevention, 2005 - cebp.aacrjournals.org
... interrelated alterations in key signaling routes, including Akt, Stat3, and NF ... known
carcinogens requiring the aryl hydrocarbon receptor (AhR)-mediated pathway ...
Web Search - cebp.aacrjournals.org - ncbi.nlm.nih.gov
Interleukin-4 receptor signaling pathways in asthma pathogenesis
TA CHATILA - Trends Mol. Med, 2004 - immuneweb.xxmc.edu.cn
... a more sustained inflammatory response characterized by the influx of eosinophils
and other inflammatory cells, tissue edema and protracted AHR. ... Tyk2 Stat3 YY ...
Cited by 3 - View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Molecular cloning and characterization of a murine pre-B-cell growth-stimulating factor/stromal cell … - Full text - MIT Libraries
T Nagasawa, T Nakajima, K Tachibana, H Iizasa, CC … - Proc. Natl. Acad. Sci. USA, 1996 - dx.doi.org
... page B. Ahr, M. Denizot, V. Robert-Hebmann, A. Brelot, and M. Biard-Piechaczyk
Identification of the Cytoplasmic Domains of CXCR4 Involved in Jak2 and STAT3 ...
Cited by 82 - Web Search - pnas.org - cbrinstitute.org - cbr.med.harvard.edu - all 8 versions »
The Role of Interleukin-4 and Interleukin-13 in the Non-Immunologic Aspects of Asthma Pathogenesis
K Izuhara - Clin Chem Lab Med, 2003 - degruyter.com
... epithelial cells into STAT6-dis- rupted mice restores IL-13-induced AHR and mucous ...
factor for IL-13 to exert its biological ac- tivities, and STAT3 (23, 27 ...
Cited by 2 - Web Search - extenza-eps.com - degruyter.de - ncbi.nlm.nih.gov - all 8 versions » - Get it from MIT Libraries
POSTER SESSIONS
PW GPCR - blackwellpublishing.com
... CXCR4 in Gi-dependent and -independent signals after SDF-1 binding B. Ahr, V. Robert ...
and -independent events (receptor internalization, NF-KB or STAT3 activation ...
View as HTML - Web Search - ingentaconnect.com
T Cell-Specific Disruption of Arylhydrocarbon Receptor Nuclear Translocator(Arnt) Gene Causes … - Full text - MIT Libraries
S Tomita, HB Jiang, T Ueno, S Takagi, K Tohi, SI … - Journal of Immunology, 2003 - jimmunol.org
... Characterization of a murine Ahr null allele: involvement of the Ah ... Keratinocyte-
specific ablation of Stat3 exhibits impaired skin remodeling, but does not ...
Cited by 5 - Web Search - jimmunol.org - ncbi.nlm.nih.gov - csa.com - all 5 versions »
Charles D. Johnson, Yoganand Balagurunathan, 3 Mahlet G. Tadesse, 4 M. Hadi Falahatpisheh, Marcel …
BEHP Publications, VS Cart, T Archives, C … - ehp.niehs.nih.gov
... Aryl hydrocarbon receptor knockout mice (AHR-/-) exhibit liver retinoid accumulation
and ... mammary gland involution in mice with a conditional knockout of Stat3. ...
Cached - Web Search - ehis.niehs.nih.gov - ehp.niehs.nih.gov - ehpnet1.niehs.nih.gov - all 6 versions »
IL-9 in Allergic Inflammation - Full text - MIT Libraries
I Receptor - Int Arch Allergy Immunol, 2004 - content.karger.com
... IL-9. IL-9 also plays an important role in the development of AHR and an ... Roost E,
Stevens M, Groner B, Renauld JC: Distinct roles for STAT1, STAT3, and STAT5 ...
Web Search - content.karger.com
Multiple tyrosine residues in the cytosolic domain of the erythropoietin receptor promote activation … - Full text - MIT Libraries
U Klingmueller, S Bergelson, JG Hsiao, HF Lodish - Biochemistry, 1996 - dx.doi.org
... page B. Ahr, M. Denizot, V. Robert-Hebmann, A. Brelot, and M. Biard-Piechaczyk
Identification of the Cytoplasmic Domains of CXCR4 Involved in Jak2 and STAT3 ...
Cited by 79 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
An autoregulatory loop controlling CYP1A1 gene expression: role of H 2 O 2 and NFI - Full text - MIT Libraries
Y Morel, N Mermod, R Barouki - Mol Cell Biol, 1999 - mcb.asm.org
... Autoregulation of the Stat3 gene through cooperation with a cAMP-responsive element ...
Cooperative interaction between AhR.Arnt and Sp1 for the drug-inducible ...
Cited by 31 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Epidermal growth factor receptor family tyrosine kinases as signal integrators and therapeutic …
CJ Barnes, R Kumar - Cancer Metastasis Rev, 2003 - springerlink.com
... RA, Drenning SD, Gooding WE, Wentzel AL, Xi SC, Grandis JR: STAT3 activation abrogates ...
Solbach C, Roller M, Ahr A, Loibl S, Nicoletti M, Stegmueller M, Kreysch ...
Cited by 5 - Web Search - kluweronline.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The Role of STATs in Inflammation and Inflammatory Diseases
S PATHWAY - Current Pharmaceutical Design, 2004 - ingentaconnect.com
... In fibroblast and lympho- cytes inhibition of STAT3 might be beneficial whereas ... type
immune response process such as airway hyperreactivity (AHR) and allergen ...
Web Search
Unraveling Gene-Gene Interactions Regulated by Ligands of the Aryl Hydrocarbon Receptor - Full text - MIT Libraries
CD Johnson, Y Balagurunathan, MG Tadesse, MH … - Environmental Health Perspectives, 2004 - ehpnet1.niehs.nih.gov
... The goal of this study was to unravel biological networks regulated by ligands
of the aryl hydrocarbon receptor (Ahr). ... Ahr signaling. ...
Cited by 5 - View as HTML - Web Search - gsp.tamu.edu - cceb.upenn.edu - earthscape.org - all 11 versions »
Environmental Health Environmental Health
CD Johnson, Y Balagurunathan, MG Tadesse, MH … - ee.tamu.edu
... Page 3. 2 Running Title: GENE-GENE INTERACTIONS REGULATED BY AHR LIGANDS 1 2 3 ... TCDD
α-actin Actc1 Ahr nuclear translocator Arnt Aryl hydrocarbon receptor Ahr ...
View as HTML - Web Search - ehp.niehs.nih.gov
Ephrin-B reverse signaling induces expression of wound healing associated genes in IEC-6 intestinal …
C Hafner, S Meyer, I Hagen, B Becker, A Roesch, M … - wjgnet.com
... A,T E,T CAST 1.500 IL6ST 2.100 DUSP1 1 3.500 PIM1 -1.500 P A,B STAT3 1.700 VEGF
2.300 SERPINE1 2.800 ... CDKN1A 1.700 COPEB 2.500 AHR 1.600 SP1 1.900 CDKN1B 2.000 ...
View as HTML - Web Search - wjgnet.com
Alteration of the 4-sphingenine scaffolds of ceramides in keratinocyte-specific Arnt-deficient mice … - Full text - MIT Libraries
S Takagi, H Tojo, S Tomita, S Sano, S Itami, M … - J. Clin. Invest, 2003 - jci.org
... as AHR and HIF1 , act by detecting environmental contaminants through AHR ligand
binding ... as previously reported for mice bearing Pig-a and Stat3-floxed alleles ...
Cited by 4 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Transcription Factors: New Targets for Antiallergic Therapy
DQE Hamelmann - Pathobiology, 2002 - content.karger.com
... may lead to attenuated development of airway inflammatory responses and AHR in a ...
C, Nissen MH, Ropke C, Wasik MA, Odum N: Constitutive STAT3- activation in ...
Web Search - content.karger.com
The IL-6R {alpha} chain controls lung CD4 CD25 Treg development and function during allergic airway … - Full text - MIT Libraries
A Doganci, T Eigenbrod, N Krug, GT De Sanctis, M … - J. Clin. Invest, 2005 - jci.org
... and intracellular activation of Src and JAK, which in turn phosphorylate STAT3
(19-23 ... asthma in mice associated with Th2-mediated airway inflammation and AHR (28 ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - pubmedcentral.nih.gov - jci.org
A novel computational approach for the prediction of networked transcription factors of Ah-receptor … - Full text - MIT Libraries
A Kel, S Reymann, V Matys, P Nettesheim, E … - Molecular Pharmacology, 2004 - molpharm.aspetjournals.org
... transcription factor AhR (aryl hydrocarbon receptor) that mediates responses to
a variety of ... of the transcriptional network of AhR target genes are needed. ...
Cited by 3 - Web Search - molpharm.org - molpharm.aspetjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Assessment of signal transducer and activator of transcription 6 as a target of glucocorticoid … - Full text - MIT Libraries
NM Heller, S Matsukura, SN Georas, MR Boothby, C … - Clinical & Experimental Allergy, 2004 - blackwell-synergy.com
... activity has been previously shown in the STAT1 [63], STAT3 [64], STAT4 [65 ... on airway
epithelial responses to IL-13, such as MUC5AC expression, AHR and goblet ...
Web Search - ncbi.nlm.nih.gov
SOCS proteins in T helper cell differentiation: implications for allergic disorders?
HIM Kubo - journals.cambridge.org
... The phosphorylation of STAT3 is drastically prolonged in macrophages derived from ...
degree of airflow obstruction, airway hyper- responsiveness (AHR; defined by ...
Web Search
Stimulation of hepatic signal transducer and activator of transcription 5b by GH is not altered by 3 … - Full text - MIT Libraries
YE Timsit, DS Riddick - Endocrinology, 2002 - endo.endojournals.org
... 17, 18), and there is some evidence for a role of the AHR in this ... activation is
inhibited by substances such as endotoxin (STAT5) (25), ethanol (STAT3) (26, 27 ...
Cited by 2 - Web Search - endo.endojournals.org - ncbi.nlm.nih.gov
Expression of drug-metabolizing enzymes, nuclear transcription factors and ABC transporters in Caco- …
J Borlak, C Zwadlo - Xenobiotica, 2003 - dx.doi.org
Page 1. Expression of drug-metabolizing enzymes, nuclear transcription factors
and ABC transporters in Caco-2 cells J. BORLAK* and ...
Cited by 1 - Web Search - taylorandfrancis.metapress.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Statistical methods for joint data mining of gene expression and DNA sequence database
MD Curran, H Liu, F Long, N Ge - SIGKDD Explorations Special Issue on Microarray Data Mining, 2003 - portal.acm.org
... STAT1 STAT3 -- STAT_C 71.8% ... selection procedures described in Section 2.5 are applied,
the 16 main effects remaining in the final model are ATF6, AhR, c-Ets-1 ...
Cited by 3 - Web Search - acm.org - portal.acm.org
BMC Genomics - Full text - MIT Libraries
JJ Hutton, AG Jegga, S Kong, A Gupta, C Ebert, S … - BMC Genomics, 2004 - biomedcentral.com
... Ctsl NM_009984 Ccl22 NM_009137 Stat3 BC003806 ... protein kinase (MAPK) signaling path-
way during positive selection in the thymus [32]; and AhR is known to ...
Cited by 1 - View as HTML - Web Search - dx.doi.org - pubmedcentral.nih.gov - bmc.ub.uni-potsdam.de - all 8 versions »
ROLE OF C 5 A IN INFLAMMATORY RESPONSES - Full text - MIT Libraries
RF Guo, PA Ward - Annual Review of Immunology, 2005 - arjournals.annualreviews.org
Page 1. 22 Dec 2004 19:25 AR AR239-IY23-24.tex XMLPublish SM (2004/02/24) P1:
JRX AR REVIEWS IN ADVANCE10.1146/annurev.immunol.23.021704 ...
Web Search - arjournals.annualreviews.org - ncbi.nlm.nih.gov
Spred-1 negatively regulates allergeninduced airway eosinophilia and hyperresponsiveness - Full text - MIT Libraries
H Inoue, R Kato, S Fukuyama, A Nonami, K Taniguchi … - J. Exp. Med, 2005 - jem.org
... Lower log PC 200 values represent greater AHR. ... 2003. STAP-2/BKS, an adaptor/docking
protein, modulates STAT3 activation in acute-phase response through i.
Cited by 1 - Web Search - jem.org - ncbi.nlm.nih.gov
Interaction of Xenobiotics with Myocardial Signal Transduction Pathways
RB Melchert, J Joseph, RH Kennedy - Cardiovascular Toxicology, 2002 - journals.humanapress.com
... 1 [CT-1], and interleukin [IL]-1b) are known to acti- vate the JAK ® STAT pathways
(1), and in cardiac myocytes, LIF activates JAK1, STAT3, and ERKs (23). ...
Cited by 1 - Web Search - now.humanapress.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Interleukin-18
JA Gracie, SE Robertson, IB McInnes - J Leukoc Biol, 2003 - jleukbio.org
... In general, it appears that IL-18 is primarily a negative regulator of Th2-mediated
airways hyper-reactivity (AHR) but can promote pulmonary granuloma ...
Cited by 48 - Web Search - eprints.gla.ac.uk - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
2. Cytokines and chemokines
LC Borish, JW Steinke - J Allergy Clin Immunol, 2003 - uiowa.edu
... Abbreviations used ADCC: Antibody-dependent cellular cytotoxicity AHR: Airway
hyperreactivity APC: Antigen-presenting cells GCSF: Granulocyte-colony ...
Cited by 26 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
cDNA microarray profiling of rat mammary gland carcinomas induced by 2-amino-1-methyl-6- … - Full text - MIT Libraries
L Shan, M He, M Yu, C Qiu, NH Lee, ET Liu, EG … - Carcinogenesis, 2002 - carcin.oupjournals.org
... a previous study has reported a change in the expression of STAT3 in rat ... (2000)
Expression of the aryl hydrocarbon receptor/transcription factor (AhR) and AhR ...
Cited by 13 - Web Search - carcin.oxfordjournals.org - carcin.oupjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Characterization of the survival motor neuron (SMN) promoter provides evidence for complex … - Full text - MIT Libraries
R Rouget, F Vigneault, C Codio, C Rochette, I … - Biochem. J, 2005 - biochemj.org
... Figure 2. The potential Sp1, Ets, AhR and IL-6 cis-elements were explored further.
Electrophoretic mobility shift assays ... of the putative AhR cis-element (Fig. ...
Cited by 1 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov
Rac and Protein Kinase C-{delta} Regulate ERKs and Cytosolic Phospholipase A 2 in Fc {epsilon} RI … - Full text - MIT Libraries
SH Cho, HJ You, CH Woo, YJ Yoo, JH Kim - The Journal of Immunology, 2004 - jimmunol.org
... Determination of airway hyper-responsiveness (AHR) to methacholine (MCh).
AHR to increasing doses of nebulized MCh was assessed in ...
Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
zur Erlangung des Doktorgrades der Naturwissenschaften
CM Litterst - publikationen.ub.uni-frankfurt.de
... STAT6 gefunden. Während STAT3 und STAT5 in den meisten Zelltypen ... Entzündungen der
Atemwege sowie Airway-Hyperresponsiveness (AHR) gekennzeichnet ist. ...
View as HTML - Web Search
Novel Methods That Facilitate Membrane Protein Studies and Elucidate Protein Redistribution and … - Full text - MIT Libraries
J Anders, M Wehsling, A Abdolzade-Bavil, D Matheis … - Proteomics, 2004 - mcponline.org
Page 1. 5.1 Novel Methods That Facilitate Membrane Protein Studies and
Elucidate Protein Redistribution and Phosphorylation Events ...
Web Search
Research Paper
R Papoian, A Scherer, M Saulnier, F Staedtler, A … - springerlink.com
Page 1. : Research Paper VeloceGenomics: An Accelerated in Vivo Drug Discovery
Approach to Rapidly Predict the Biologic, Drug-Like ...
Web Search
Chromium (VI) Down-regulates Heavy Metal-induced Metallothionein Gene Transcription by Modifying … - Full text - MIT Libraries
S Majumder, K Ghoshal, D Summers, S Bai, J Datta, … - J Biol Chem, 2003 - jbc.org
... Besides MTF1, several other transcription factors like Sp1, USF1, glucocorticoid
receptor, STAT3, are also involved in MT gene expression in response to ...
Cited by 3 - Web Search - dx.doi.org - ncbi.nlm.nih.gov
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
Page 1. BioSystems xxx (2005) xxx–xxx A statistical analysis of the TRANSFAC database
Gary B. Fogel a , Dana G. Weekes a , Gabor Varga b , Ernst R. Dow b , ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Journal of Carcinogenesis - Full text - MIT Libraries
MJ van Erk, E Teuling, YCM Staal, S Huybers, PJ … - Journal of Carcinogenesis, 2004 - bmc.ub.uni-potsdam.de
... involved in DNA repair, eg MLH1, MSH3 and ERCC2 (Tables 1 and 2). Upregulated signal
transduction genes included STAT3 and STAT5b (Table 1) and some genes of ...
View as HTML - Web Search
On the Power of Profiles for Transcription Factor Binding Site Detection
S Rahmann, T Mueller, M Vingron - Statistical Applications in Genetics and Molecular Biology, 2003 - genereg.molgen.mpg.de
Page 1. On the Power of Profiles for Transcription Factor Binding Site Detection
Sven Rahmann 1,2,∗ , Tobias Muller 1,3 , and Martin Vingron 1 ...
Cited by 11 - View as HTML - Web Search - molgen.mpg.de - gi.cebitec.uni-bielefeld.de
BRCA 1 gene in breast cancer - Full text - MIT Libraries
EM Rosen, S Fan, RG Pestell, ID Goldberg - Journal of Cellular Physiology, 2003 - doi.wiley.com
Page 1. JOURNAL OF CELLULAR PHYSIOLOGY 196:19–41 (2003) BRCA1 Gene in Breast
Cancer ELIOT M. ROSEN, 1,2,3,5 * SAIJUN FAN, 1,2 RICHARD ...
Cited by 26 - Web Search - biology.mcgill.ca - ww2.mcgill.ca - ncbi.nlm.nih.gov
The Transcriptional Regulating Protein of 132 kDa(TReP-132) Enhances P 450 scc Gene Transcription … - Full text - MIT Libraries
F Gizard, B Lavallee, F DeWitte, E Teissier, B … - J Biol Chem, 2002 - jbc.org
... For example, both the aryl hydrocarbon receptor (AhR) and the AhR nuclear translocator ...
a "bridging molecule" in the positive cross-talk between STAT3 and Smad1 ...
Cited by 17 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Time- and dose-dependent effects of curcumin on gene expression in human colon cancer cells - Full text - MIT Libraries
M van Erk, E Teuling, Y Staal, S Huybers, P van … - Journal of Carcinogenesis, 2004 - dx.doi.org
... 1 and 2). Upregulated signal transduction genes included STAT3 and STAT5b ... Expression
of the aryl hydrocarbon receptor (AHR) was also slightly downregulated at ...
Cited by 2 - Web Search - pubmedcentral.nih.gov - carcinogenesis.com - citebase.eprints.org - all 9 versions »
HEX Acts as a Negative Regulator of Angiogenesis by Modulating the Expression of Angiogenesis- … - Full text - MIT Libraries
T Nakagawa, M Abe, T Yamazaki, H Miyashita, H Niwa … - Arteriosclerosis, Thrombosis, and Vascular Biology, 2003 - atvb.ahajournals.org
... leukemia (SCL)/tal-1, CAAGTAAGAGGCTGGAGTTGTCA, AACGTGATGTCGAGGAGTTGAAG; endothelial
Per-AHR-ARNT-Sim ... embryonic stem cells is mediated via activation of STAT3. ...
Cited by 4 - Web Search - intl-atvb.ahajournals.org - ahavj.ahajournals.org - ncbi.nlm.nih.gov - all 8 versions »
|
©2005 Google