![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 66 for STAT3 and ARNT. (0.18 seconds) |
… -Specific Disruption of Arylhydrocarbon Receptor Nuclear Translocator(Arnt) Gene Causes Resistance … - Full text - MIT Libraries
S Tomita, HB Jiang, T Ueno, S Takagi, K Tohi, SI … - Journal of Immunology, 2003 - jimmunol.org
... of the aryl hydrocarbon receptor nuclear translocator (Arnt) gene leads ...
Keratinocyte-specific ablation of Stat3 exhibits impaired skin remodeling, but does ...
Cited by 5 - Web Search - jimmunol.org - ncbi.nlm.nih.gov - csa.com - all 5 versions »
… of the 4-sphingenine scaffolds of ceramides in keratinocyte-specific Arnt-deficient mice affects … - Full text - MIT Libraries
S Takagi, H Tojo, S Tomita, S Sano, S Itami, M … - J. Clin. Invest, 2003 - jci.org
... When mice containing an Arnt allele with exon 6 flanked by loxP sites (14 ... keratinocytes,
as previously reported for mice bearing Pig-a and Stat3-floxed alleles ...
Cited by 4 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Efficient in vivo manipulation of mouse genomic sequences at the zygote stage - Full text - MIT Libraries
M Lakso, JG Pichel, JR Gorman, B Sauer, Y Okamoto, … - Genetics, 1996 - dx.doi.org
... in Postnatal Survival and Growth Revealed by Mice Lacking STAT3 Serine 727 ... 4-sphingenine
scaffolds of ceramides in keratinocyte-specific Arnt-deficient mice ...
Cited by 181 - Web Search - pnas.org - milkpa.idv.tw - pubmedcentral.nih.gov - all 6 versions »
Human Embryonic Stem Cells: Frontiers in Basic Research and Generation of Cell Technologies( …
OF Gordeeva - Russian Journal of Developmental Biology, 2004 - springerlink.com
... specific differences in the expression of genes, such as vimentin, β-III-tubulin,
α- fetoprotein, eomesodermin, HEB, ARNT, FoxD3, gp130, STAT3, CD34, etc. ...
Web Search - kluweronline.com - ingentaconnect.com
Tissue-specific knockout of the mouse Pig-a gene reveals important roles for GPI-anchored proteins … - Full text - MIT Libraries
M Tarutani, S Itami, M Okabe, M Ikawa, T Tezuka, K … - Proc. Natl. Acad. Sci. USA, 1997 - dx.doi.org
... Specific Disruption of Arylhydrocarbon Receptor Nuclear Translocator (Arnt) Gene
Causes ... and J. Takeda Keratinocyte-specific ablation of Stat3 exhibits impaired ...
Cited by 63 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Dual Role of Insulin in Transcriptional Regulation of the Acute Phase Reactant Ceruloplasmin - Full text - MIT Libraries
V Seshadri, PL Fox, CK Mukhopadhyay - J Biol Chem, 2002 - jbc.org
... Mouse wild-type Hepa-1c1c7 and HIF-1 /ARNT-deficient Hepa c4 cells were ... IL-6-activated
"acute phase response factor" has been shown to be STAT3, which binds to ...
Cited by 3 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
beta-Naphthoflavone disturbs astrocytic differentiation of C 6 glioma cells by inhibiting autocrine … - Full text - MIT Libraries
H Takanaga, T Yoshitake, E Yatabe, S Hara, M … - Journal of Neurochemistry, 2004 - blackwell-synergy.com
... its cofactor aryl hydrocarbon receptor nuclear translocator (ARNT), respectively,
specify ... signal transducer and activator of transcription 3 (STAT3), and the ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Mechanisms of Hypoxic Gene Regulation of Angiogenesis Factor Cyr 61 in Melanoma Cells - Full text - MIT Libraries
M Kunz, S Moeller, D Koczan, P Lorenz, RH Wenger, … - J Biol Chem, 2003 - jbc.org
... analysis using -c-Jun, -c-Fos, -ATF2, -JunB, -JunD, and anti-STAT3 Abs, respectively ...
transfected with a combination of c-Jun, HIF-1 , and ARNT carrying plasmid ...
Cited by 9 - Web Search - southalabama.edu - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
GABAergic Nature of Hypothalamic Leptin Target Neurones in the Ventromedial Arcuate Nucleus - Full text - MIT Libraries
ML Ovesjo, M Gamstedt, M Collin, B Meister - Journal of Neuroendocrinology, 2001 - blackwell-synergy.com
... we have examined whether GABA neurones of the hypothalamic arcuate nucleus contain
leptin receptors and the leptin-activated transcription factor STAT3. ...
Cited by 18 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Gene expression by human monocytes from peripheral blood in response to exposure to metals
K Jost-Albrecht, W Hofstetter - cx.unibe.ch
Page 1. Gene expression by human monocytes from peripheral blood in response
to exposure to metals Katrin Jost-Albrecht, Willy Hofstetter ...
View as HTML - Web Search
HIF-1 α, STAT 3, CBP/p 300 and Ref-1/APE are components of a transcriptional complex that regulates … - Full text - MIT Libraries
MJ Gray, J Zhang, LM Ellis, GL Semenza, DB Evans, … - Oncogene, 2005 - nature.com
... also known as aryl hydrocarbon receptor nuclear translocator (ARNT)) and associates ...
recently, signal and transducer of transcription 3 (STAT3) activation has ...
Web Search - nature.com - ncbi.nlm.nih.gov
Progression of head and neck squamous cell cancer
H Budapest - Cancer and Metastasis Reviews, 2005 - springerlink.com
... pathways, (Bcl-2/Bax system in p53- tumors) as well as the STAT3-cyclinD1 control ...
is HIF-1, a heterodimer of the HIF-1α transcription factor and ARNT/HIF-1β ...
Web Search - ingentaconnect.com
Statistical methods for joint data mining of gene expression and DNA sequence database
MD Curran, H Liu, F Long, N Ge - SIGKDD Explorations Special Issue on Microarray Data Mining, 2003 - portal.acm.org
... OCT-x OCT1 -- OCT_C 42.1% STAT1 STAT3 -- STAT_C 71.8% ... Muscle initiator sequence-20
Muscle initiator sequence-19 -- Muscle_C 89.0% Arnt Max -- ArMx_C 0.0% ...
Cited by 3 - Web Search - acm.org - portal.acm.org
The use of c-src knockout mice for the identification of the main toxic signaling pathway of TCDD to …
CFA Vogel, Y Zhao, P Wong, NF Young, F Matsumura - Journal of Biochemical and Molecular Toxicology, 2003 - doi.wiley.com
... NFkB. Elevation of mRNAs for TGF and STAT3 was observed only on day 10
and day 30. To ... Another study on STAT3 showed that its mRNA ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - csa.com - Get it from MIT Libraries
An autoregulatory loop controlling CYP1A1 gene expression: role of H 2 O 2 and NFI - Full text - MIT Libraries
Y Morel, N Mermod, R Barouki - Mol Cell Biol, 1999 - mcb.asm.org
... signal transduction pathways: competition for recruitment of the Arnt transcription
factor. ... Autoregulation of the Stat3 gene through cooperation with a cAMP ...
Cited by 31 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
The Jak/STAT pathway in model organisms: emerging roles in cell movement - Full text - MIT Libraries
SX Hou, Z Zheng, X Chen, N Perrimon, Z Renio - Dev. Cell, 2002 - invivo.caltech.edu
... similar to mammalian JAK2 (27% identity; Binari and and zebrafish STAT1 and STAT3
have 63.9% and 86.5% ... This region constitutes a change relative to STAT3. ...
Cited by 29 - View as HTML - Web Search - lifesci.sussex.ac.uk - genetics.med.harvard.edu - all 7 versions »
Environmental Health Environmental Health
CD Johnson, Y Balagurunathan, MG Tadesse, MH … - ee.tamu.edu
... TCDD α-actin Actc1 Ahr nuclear translocator Arnt Aryl hydrocarbon receptor Ahr ... Nf-
κ b Osteopontin / secreted phosphoprotein 1 Opn Per-AHR-ARNT-Sim Pas ...
View as HTML - Web Search - ehp.niehs.nih.gov
Erythropoietin: physiology and pharmacology update - Full text - MIT Libraries
JW Fisher - Exp Biol Med, 2003 - ebmonline.org
... EPO is also well known to activate STAT1, STAT3, STAT5A, and STAT5B (64 ... HIF-1ß, the
aryl hydrocarbon nuclear translocator (ARNT), is involved in the xenobiotic ...
Cited by 39 - Web Search - ebmonline.org - ebmonline.org - ncbi.nlm.nih.gov - all 5 versions »
Conditional alleles in mice: Practical considerations for tissue-specific knockouts - Full text - MIT Libraries
KM Kwan - genesis, 2002 - doi.wiley.com
... Apc 18 (15.0) Œ Shibata et al., 1997 Arnt (aryl hydrocarbon receptor unclear
translocator) 3 (47.9) F Tomita et al., 2000 ... unknown F Wiebel et al., 2002* Stat3 ...
Cited by 27 - Web Search - tagc.univ-mrs.fr - biochem.wisc.edu - ncbi.nlm.nih.gov - all 6 versions »
Analysis of the interaction of TIP60β and PIN1 with the ets family transcription factor ETV6
CD Zhang - edoc.ub.uni-muenchen.de
... HLXB9, MN1 or PAX5, to genes of various or unknown functions, such as STL, BTL,
ARNT, MDS2, TTL, ACS2. ... TIP60 interacts with STAT3 and represses STAT3-mediated ...
View as HTML - Web Search
Hypoxic Preconditioning Protects against Ischemic Brain Injury - Full text - MIT Libraries
FR Sharp, R Ran, A Lu, Y Tang, KI Strauss, T Glass … - Neurorx, 2004 - neurorx.org
... 77 HIF-1ß, also called ARNT, is expressed constitutively in all cells, does not ... TGF,
interferon, IL-1, IL-6, TNF, Egr-1, estrogen, calcium, STAT3, p44/p42 MAPK ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - neurorx.org - ncbi.nlm.nih.gov
Erythropoietin on a Tightrope: Balancing Neuronal and Vascular Protection between Intrinsic and …
F Li, ZZ Chong, K Maiese, K Maiese, F Alert - Neurosignals, 2004 - content.karger.com
... was characterized previously as aryl hydrocarbon receptor nuclear translocator
(ARNT) [40 ... ATP levels, and functional recovery increased; Jak2, STAT3, STAT5, ERK ...
Cited by 2 - Web Search - content.karger.com - dx.doi.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
APOPTOTIC PATHWAYS IN CANCER PROGRESSION AND TREATMENT
J CHANDRA, SH KAUFMANN - doi.wiley.com
Page 1. 143 CHAPTER 4 APOPTOTIC PATHWAYS IN CANCER PROGRESSION AND TREATMENT
JOYA CHANDRA and SCOTT H. KAUFMANN Division of Oncology ...
Web Search
Transcriptional Activation by STAT 6 Requires the Direct Interaction with NCoA-1 - Full text - MIT Libraries
CM Litterst, E Pfitzner - J Biol Chem, 2001 - jbc.org
... Although STAT3 and STAT5 are expressed in most cell types and acti ... polyacrylamide
gel electrophoresis; TAD, trans- activation domain; PAS, Per-Arnt-Sim; NID ...
Cited by 20 - Web Search - jbc.org - dx.doi.org - ncbi.nlm.nih.gov
Charles D. Johnson, Yoganand Balagurunathan, 3 Mahlet G. Tadesse, 4 M. Hadi Falahatpisheh, Marcel …
BEHP Publications, VS Cart, T Archives, C … - ehp.niehs.nih.gov
... The Ahr/Arnt heterodimer interacts with Ahr-responsive elements (5´-TNGCGTG-3 ... delayed
mammary gland involution in mice with a conditional knockout of Stat3. ...
Cached - Web Search - ehis.niehs.nih.gov - ehp.niehs.nih.gov - ehpnet1.niehs.nih.gov - all 6 versions »
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
Page 1. BioSystems xxx (2005) xxx–xxx A statistical analysis of the TRANSFAC database
Gary B. Fogel a , Dana G. Weekes a , Gabor Varga b , Ernst R. Dow b , ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Id proteins in epithelial cells - Full text - MIT Libraries
JP Coppe, AP Smith, PY Desprez - Exp Cell Res, 2003 - lbl.gov
... have been shown to dimerize and mediate signal transduction are Arnt and the ... PI3K
(phopshatidylinosit- ide 3-kinase) pathways as well as the Stat3 pathway also ...
Cited by 15 - View as HTML - Web Search - ncbi.nlm.nih.gov
A novel computational approach for the prediction of networked transcription factors of Ah-receptor … - Full text - MIT Libraries
A Kel, S Reymann, V Matys, P Nettesheim, E … - Molecular Pharmacology, 2004 - molpharm.aspetjournals.org
... carbinol (I3C). The nuclear AhR complex is a heterodimer composed of the
AhR and AhR nuclear translocator (Arnt) proteins. Binding ...
Cited by 3 - Web Search - molpharm.org - molpharm.aspetjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Synergistic Cooperation between Hypoxia and Transforming Growth Factor-beta Pathways on Human … - Full text - MIT Libraries
T Sanchez-Elsner, LM Botella, B Velasco, A Corbi, … - J Biol Chem, 2001 - intl.jbc.org
... to bind independently and transactivate target gene promoters; Smad1 and STAT3,
bridged by ... 1 and the aryl hydrocarbon receptor nuclear translocator (ARNT or HIF ...
Cited by 46 - Web Search - jbc.org - jbc.org - ncbi.nlm.nih.gov
Unraveling Gene-Gene Interactions Regulated by Ligands of the Aryl Hydrocarbon Receptor - Full text - MIT Libraries
CD Johnson, Y Balagurunathan, MG Tadesse, MH … - Environmental Health Perspectives, 2004 - ehpnet1.niehs.nih.gov
... in myoblast differentiation, such as myogenic differentiation antigen 1; the cellular
response to hypoxia, such as Ahr nuclear translocator (Arnt) and hypoxia ...
Cited by 5 - View as HTML - Web Search - gsp.tamu.edu - cceb.upenn.edu - earthscape.org - all 11 versions »
The Insulin-like Growth Factors and Insulin-signalling Systems: An Appealing Target for Breast … - Full text - MIT Libraries
SG Gray, I Stenfeldt Mathiasen, P De Meyts - Horm. Metab. Res, 2003 - thieme-connect.com
... 5 in mammary gland involution has been further confirmed by STAT3 knockout mice ...
stimulates the transcription of VEGF by HIF-1α/ARNT transcriptional complex [34 ...
Cited by 2 - Web Search - thieme-connect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Structural and functional characterization of the mouse Hlx homeobox gene - Full text - MIT Libraries
MD Bates, LC Schatzman, T Lints, PE Hamlin, RP … - Mammalian Genome, 2000 - springerlink.com
... A AML-1 + 2923 11 Meyers et al. 1993 A Stat1/Stat3 − 2947 36 Horvath et al. 1995
A aryl hydrocarbon receptor/ARNT + 2966 58 Swanson et al. 1995 ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
G ENETIC P ROFILE OF A CUTE M YELOID L EUKEMIA - Full text - MIT Libraries
C Mecucci, R Rosati, R La Starza - Reviews in Clinical & Experimental Hematology, 2002 - blackwell-synergy.com
... of ETV6 and almost all the aryl hydrocarbon receptor nuclear translocator (ARNT)
protein ... of c-kit mutant leukemic clones, such as STAT3 and phosphatidylinositol ...
Cited by 4 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
NCoA-1/SRC-1 Is an Essential Coactivator of STAT 5 That Binds to the FDL Motif in the{alpha}-Helical … - Full text - MIT Libraries
CM Litterst, S Kliem, D Marilley, E Pfitzner - J Biol Chem, 2003 - jbc.org
... progesterone receptor, AP1, NF B, and the STAT proteins STAT1, STAT3, and STAT6 ... BHLH,
basic-helix-loop-helix; PAS, Per-Arnt-Sim homology region; NID, nuclear ...
Cited by 7 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
Erythropoietin: cytoprotection in vascular and neuronal cells
ZZ Chong, JQ Kang, K Maiese - Curr. Drug Targets Cardiovasc. Haematol. Disord, 2003 - ingentaconnect.com
... was characterized previously as aryl hydrocarbon receptor nuclear translocator
(ARNT) [19 ... Interleukin (IL)-6 employs STAT1 and STAT3 for its signal transduction ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
HEX Acts as a Negative Regulator of Angiogenesis by Modulating the Expression of Angiogenesis- … - Full text - MIT Libraries
T Nakagawa, M Abe, T Yamazaki, H Miyashita, H Niwa … - Arteriosclerosis, Thrombosis, and Vascular Biology, 2003 - atvb.ahajournals.org
... SCL)/tal-1, CAAGTAAGAGGCTGGAGTTGTCA, AACGTGATGTCGAGGAGTTGAAG; endothelial
Per-AHR-ARNT-Sim domain ... embryonic stem cells is mediated via activation of STAT3. ...
Cited by 4 - Web Search - intl-atvb.ahajournals.org - ahavj.ahajournals.org - ncbi.nlm.nih.gov - all 8 versions »
Stimulation of hepatic signal transducer and activator of transcription 5b by GH is not altered by 3 … - Full text - MIT Libraries
YE Timsit, DS Riddick - Endocrinology, 2002 - endo.endojournals.org
... is not without precedence, as it has been shown that STAT activation is inhibited
by substances such as endotoxin (STAT5) (25), ethanol (STAT3) (26, 27), and ...
Cited by 2 - Web Search - endo.endojournals.org - ncbi.nlm.nih.gov
TRANSCRIPTION FACTORS
OFB CELLS - doi.wiley.com
... proapoptotic activity, 560—561 PML growth suppression and, 335—336 AP1 protein,
PML-RAR fusion protein and, 338 ARNT transporter, TEL gene fusion and, 427 ...
Web Search
Trophoblast-uterine interactions at implantation - Full text - MIT Libraries
J Aplin, S Kimber - Reproductive Biology and Endocrinology, 2004 - dx.doi.org
... In the mouse, ablation of the hypoxia inducible gene Arnt/HIF1α leads to abnormal
placental development and pregnancy failure, suggesting a role for hypoxia ...
Cited by 3 - Web Search - pubmedcentral.nih.gov - rbej.com - citebase.eprints.org - all 9 versions »
[BOOK] Cellular and molecular biology of nitric oxide
JD Laskin, DL Laskin - 1999 - print.google.com
Page 1. Cellular and Molecular Biology of Nitric Oxide Th isOne ii llhI1I Page 2.
Cellular and Molecular Biology of Nitric Oxide Jeffrey D. Laskin ...
Cited by 3 - Web Search - Get it from MIT Libraries - Library Search
Targets of Transcriptional Regulation by Two Distinct Type I Receptors for Transforming Growth … - Full text - MIT Libraries
T OTA, M FUJII, T SUGIZAKI, M ISHII, K MIYAZAWA, H … - JOURNAL OF CELLULAR PHYSIOLOGY, 2002 - doi.wiley.com
Page 1. JOURNAL OF CELLULAR PHYSIOLOGY 193:299–318 (2002) Targets of
Transcriptional Regulation by Two Distinct Type I Receptors ...
Cited by 36 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Reproductive Biology and Endocrinology - Full text - MIT Libraries
JD Aplin, SJ Kimber - Reproductive Biology and Endocrinology, 2004 - bmc.ub.uni-potsdam.de
... In the mouse, ablation of the hypoxia inducible gene Arnt/HIF1α leads to abnormal
placental development and pregnancy fail- ure, suggesting a role for hypoxia ...
View as HTML - Web Search
ARTICLE IN PRESS
JE Lindsley, J Rutter - biochem.utah.edu
... Abbreviations: PAS, Per-Arnt-Sim; TOR, target of rapamycin; mTOR, mammalian target
of rapamycin; AMPK, 5V-AMP-dependent protein kinase; AICAR, aminoimidazole-4 ...
View as HTML - Web Search - ttuhsc.edu
Wirkmechanismen von Inhalationsnoxen in Umwelt und Beruf - Full text - MIT Libraries
H Riechelmann - Laryngorhinootologie, 2004 - thieme-connect.com
... Diese zwei Proteinkinasen aktivieren mehrere Transkriptionsfaktoren (zB c-Jun, STAT1,
STAT3, c-Myc, CREB) die Zellwachstum und -teilung anregen und an der ...
Web Search
Identification of Potential Stroke Targets by Lentiviral Vector Mediated Overexpression of HIF-1 and …
GS Ralph, S Parham, SR Lee, GL Beard, MH Craigon, … - Journal of Cerebral Blood Flow & Metabolism - nature.com
Page 1. Identification of Potential Stroke Targets by Lentiviral Vector Mediated
Overexpression of HIF-1 and HIF-2 in a Primary Neuronal Model of Hypoxia ...
View as HTML - Web Search
Targeting the type 1 insulin-like growth factor receptor as anti-cancer treatment. - Full text - MIT Libraries
EA Bohula, MP Playford, VM Macaulay, K Nakaya, T … - Anti-Cancer Drugs-, 2003 - anti-cancerdrugs.com
... Stat3 plays an important role in oncogenic Ros- and insulin-like growth
factor I receptor-induced anchorage-independent growth. ...
Cited by 5 - Web Search - anti-cancerdrugs.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
RESPONSES TO HYPOXIA VIA mTOR
W Li, A Qingdao, V China - pages.unibas.ch
Page 1. RESPONSES TO HYPOXIA VIA mTOR Role in Endothelial Cell Proliferation
and HIF-1α Stabilization Inauguraldissertation zur ...
View as HTML - Web Search - pages.unibas.ch
The Transcriptional Regulating Protein of 132 kDa(TReP-132) Enhances P 450 scc Gene Transcription … - Full text - MIT Libraries
F Gizard, B Lavallee, F DeWitte, E Teissier, B … - J Biol Chem, 2002 - jbc.org
... aryl hydrocarbon receptor (AhR) and the AhR nuclear translocator (Arnt), which form ...
as a "bridging molecule" in the positive cross-talk between STAT3 and Smad1 ...
Cited by 17 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Technical Bulletin
H Protein, H ELISA - sigmaaldrich.com
Page 1. Panorama ™ Human Protein Function Microarray Cancer v1 Technical Bulletin
Catalog Number HPFM2 HPFM2_TechBul .indd i HPFM2_TechBull.indd i ...
View as HTML - Web Search - sigmaaldrich.com
Discrimination of Vanadium from Zinc Using Gene Profiling in Human Bronchial Epithelial Cells
Z Li, J Stonehuerner, RB Devlin, YCT Huang - ehp.niehs.nih.gov
Page 1. Discrimination of Vanadium from Zinc Using Gene Profiling in Human Bronchial
Epithelial Cells Zhuowei Li, Jackie Stonehuerner, Robert B. Devlin, ...
View as HTML - Web Search - ehp.niehs.nih.gov
| |
©2005 Google