![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 94 for STAT3 and EGR1. (0.20 seconds) |
Early gene expression in wounded human keratinocytes revealed by DNA microarray analysis
G Ponzio, P Barbry - doi.wiley.com
... for genes such as c-Fos, c-Jun, Egr1, the plasminogen activator PLAU (uPA) and the
signal transducer and transcription activator STAT3, were consistent with ...
Web Search - ingentaconnect.com - pc-212-pb23.ipmc.cnrs.fr - medlab.ipmc.cnrs.fr
Induction of apoptosis by extracellular ubiquitin in human hematopoietic cells: possible involvement … - Full text - MIT Libraries
H Daino, I Matsumura, K Takada, J Odajima, H … - Blood, 2000 - bloodjournal.org
... 25 , 26 Supporting our observation that STAT3 is severely degraded by Ub treatment,
IL-6 ... cells (Figure 4A). Although IL-6 was found to induce IRF-1, Egr1, c-fos ...
Cited by 18 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Temporal Changes in Gene Expression after Injury in the Rat Retina - Full text - MIT Libraries
F Vazquez-Chona, BK Song, EE Geisert Jr - Investigative Ophthalmology & Visual Science, 2004 - iovs.org
... 30 For example, early gene expression of the transcription factors c-Fos, Fosl1
(Fra-1), Nfkb1, Stat3, Egr1 (Krox-24/NGFI-A), Cebpd, Atf3, and Irf1 has been ...
Cited by 1 - Web Search - genome-explorations.com - genomeexplorations.com - ncbi.nlm.nih.gov - all 6 versions »
Neuroendocrine cells in prostate cancer.
GP Amorino, SJ Parsons - Crit Rev Eukaryot Gene Expr, 2004 - ncbi.nlm.nih.gov
... Transcription factors implicated in the acquisition of NE characteristics by prostate
cancer cells include STAT3, CREB, EGR1, c-fos, and NF-kappaB. ...
Web Search - Get it from MIT Libraries
STAT 3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells - Full text - MIT Libraries
T Matsuda, T Nakamura, K Nakao, T Arai, M Katsuki, … - The EMBO Journal, 1999 - embojournal.npgjournals.com
... blot analysis showed that junB and egr1 were induced (Figure 6C). JunB is one of
the known targets of STAT3 (Fujitani et al., 1994 ), whereas egr1 is thought ...
Cited by 101 - Web Search - emboj.org - nature.com - ncbi.nlm.nih.gov - all 7 versions »
GEArray Q series Mouse cAMP/Ca2+ PathwayFinder Gene Array: AR-SAMM-028
FG Grouping - eurogentec.com
... Transcription: Atf3, Creb1, Crem, Egr1, Egr2, Fos, Jund1, Maf2-Ests, Nr4a2
(Nur77), Per1, Pit1, Pou2af1 (OCA- B), Stat3 Metabolic ...
View as HTML - Web Search - eurogentec.be
GEArray Q series Human cAMP/Ca2+ PathwayFinder Gene Array: AR-SAHS-028
FG Grouping - eurogentec.com
... Transcription: ATF3, CREB1, CREM, EGR1, EGR2, FOS, JUND, MAF, NR4A2 (Nur77),
PER1, POU1F1 (Pit-1), POU2AF1 (OCA-B), STAT3 Metabolic ...
View as HTML - Web Search - eurogentec.be
Oligo GEArray® Human Hematopoietic Stem Cells and Hematopoiesis Microarray
S Conditions - search.cosmobio.co.jp
... and Regulators: ASH2L, BCL11A, CBFB, CD80, CD86, CEBPE, CEBPG, EGR1, ETS1, ETV6 ... NOTCH2,
NOTCH4, PAX5, RBPSUH, RHOH, RUNX1, SCAND1, STAT1, STAT3, STAT4, TAL1 ...
View as HTML - Web Search
Opposing Roles of Elk-1 and Its Brain-specific Isoform, Short Elk-1, in Nerve Growth Factor-induced … - Full text - MIT Libraries
P Vanhoutte, JL Nissen, B Brugg, BD Gaspera, MJ … - J Biol Chem, 2001 - jbc.org
... in the promoter of many immediate early genes (c-fos, egr1, egr2, pip92 ... 1 (Santa
Cruz Biotechnology), Zif268 (Santa Cruz Biotechnology), and STAT3 (New England ...
Cited by 16 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
Signaling Induced by Erythropoietin and Stem Cell Factor in UT-7/Epo Cells: Transient versus … - Full text - MIT Libraries
CL Erickson-Miller, LM Pelus, KA Lord - Stem Cells, 2000 - stemcells.alphamedpress.org
... the p42/44 MAPK pathway and the early response genes c-fos and egr1, activation
is ... 3 , panel 5 and 6). STAT1 and STAT3 were not phosphorylated on tyrosine by ...
Cited by 5 - Web Search - immuneweb.xxmc.edu.cn - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Identification of a Genetic Signature of Activated Signal Transducer and Activator of Transcription … - Full text - MIT Libraries
JV Alvarez, PG Febbo, S Ramaswamy, M Loda, A … - Cancer Research, 2005 - cancerres.aacrjournals.org
... STAT3 targets we identified, and specifically those present in the STAT3 signature,
are themselves transcription factors. These include junB, egr1, KLF4, bcl-6 ...
Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov
Growth Hormone Receptor Signalling and Actions in Bone Growth
PA Kelly, J Finidori, S Moulin, C Kedzia, N Binart … - Hormone Research, 2001 - content.karger.com
... is required for this effect, it appears that Stat1 and Stat3 activation is ... MAP kinase
substrates include the ternary complex factor or Elk1, Egr1, and JunB. ...
Cited by 3 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Alcohol-Induced c-Fos Expression in the Edinger-Westphal Nucleus: Pharmacological and Signal … - Full text - MIT Libraries
RK Bachtell, NO Tsivkovskaia, AE Ryabinin - Alcohol, 2002 - jpet.aspetjournals.org
... may be involved is the observation that c-Fos, but not Egr1 is induced ... that serine
727-phosphorylated, but not tyrosine 705-phosphorylated Stat3 was enhanced ...
Cited by 8 - Web Search - intl-jpet.aspetjournals.org - ncbi.nlm.nih.gov
Novel nuclear signaling pathway mediates activation of fibroblast growth factor-2 gene by type 1 and … - Full text - MIT Libraries
H Peng, J Moffett, J Myers, X Fang, EK Stachowiak, … - Mol Biol Cell, 2001 - molbiolcell.org
... TTT(CTGG)AAATG-3' (STAT1/2), and 5'-GATCCATTT (CCCGT)AAATC-3' (STAT3/4), with ...
acetyltransferase reporter gene and its regulation by p53 and Egr1 (Biesiada et ...
Cited by 24 - Web Search - intl.molbiolcell.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Induction of the interleukin-2/15 receptor-chain by the EWS-WT1 translocation product - Full text - MIT Libraries
JC Wong, SB Lee, MD Bell, PA Reynolds, E Fiore, I … - Oncogene, 2002 - nature.com
... is correlated with activation of the downstream transcrip- tion factors STAT3 and
STAT5 ... protein (GABP), Sp1, and early growth response protein 1 (EGR1) (Figure ...
Cited by 9 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Gene Expression Profiling of Testosterone and Estradiol-17ss-Induced Prostatic Dysplasia in Noble … - Full text - MIT Libraries
CJ Thompson, NNC Tam, JM Joyce, I Leav, S Ho - Endocrinology - endo.endojournals.org
... 3 ), with EGR1 showed significant overexpression and meprin ß significant
underexpression in the ... was represented by genes encoding GADD45, FRA2, and STAT3 ( ...
Cited by 5 - Web Search - endo.endojournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Gene expression associated with interferon alfa antiviral activity in an HCV replicon cell line - Full text - MIT Libraries
H Zhu, H Zhao, CD Collins, SE Eckenrode, Q Run, RA … - Hepatology, 2003 - doi.wiley.com
... P-STAT1 and P-STAT3 denote the phosphorylated proteins. ... ANXA7 NM_009674 2.19 MMP13
NM_008607 2.37 EGR1 NM_001964 2.17 FABP3 U72237 2.16 IGFBP5 NM_000599 2.32 ...
Cited by 17 - Web Search - hepcvets.com - biologicalprocedures.com - ncbi.nlm.nih.gov - all 5 versions »
GEArray S Series Human Immunology Signaling Pathways Gene Array: AR-SAHS-605
FG Grouping, A Molecules, I ICAM, CS Molecules, C … - eurogentec.com
... JAK and STAT Proteins: JAK1, JAK2, JAK3, STAT1, STAT2, STAT3, STAT4, STAT5A ...
Transcription Factors: ATF2, CEBPB, CREB1, CREBBP, EGFR, EGR1, EGR2, EGR3, ELK1, ...
View as HTML - Web Search - eurogentec.be
GEArray Q Series Human EGF/PDGF Signaling Pathway Gene Array: AR-SAHS-040
FG Grouping, R Ligands, N Regulators, IS Molecules - eurogentec.be
... PLCG1, PLCG2, PRKCA (PKC alpha), STAT1, STAT3, STAT5A. Target Genes Induced by
Activation of EGF / PDGF Pathways: MAPK Pathway: COL1A1, DUSP1, EGR1, ENPP2, FOS ...
View as HTML - Web Search - eurogentec.com
Growth Hormone Receptor Signalling and Actions in Bone Growth
PAKJF Stephanie, MC Kedzia, N Binart - Horm Res, 2001 - content.karger.com
... is required for this effect, it appears that Stat1 and Stat3 activation is ... MAP kinase
substrates include the ternary complex factor or Elk1, Egr1, and JunB. ...
Web Search - content.karger.com
Dominant-Negative CREB Inhibits Proliferating Cell Nuclear Antigen and DNA Repair, Leading to …
GP Amorino, RB Mikkelsen, K Valerie, RK Schmidt- … - jbc.org
... 8 transcription factors; of these, the radiation-induced activation of CREB, EGR1,
ETS2, and STAT3 totally depend on signals from EGFR, RAS, and MAPK. ...
Web Search - jbc.org
Effects of Retroviral Vector Design on Expression of Human Adenosine Deaminase in Murine Bone Marrow … - Full text - MIT Libraries
I Riviere, K Brose, RC Mulligan - Proceedings of the National Academy of Sciences - pnas.org
... LB Ivashkiv Rheumatoid Arthritis Synoviocyte Survival Is Dependent on Stat3 J. Immunol ...
of Retroviral Enhancer Mutations in Hematopoietic Cells: SP1/EGR1 and ETS ...
Cited by 124 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
The zinc finger transcription factor Egr-1 activates macrophage differentiation in M1 myeloblastic … - Full text - MIT Libraries
K Krishnaraju, B Hoffman, DA Liebermann - Blood, 1998 - bloodjournal.org
... These observations raise the possibility that Egr-1 and stat3 may use ... receptor- and
phorbol ester-stimulated B lymphocytes: Role for transcription factor EGR1. ...
Cited by 23 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Time- and dose-dependent effects of curcumin on gene expression in human colon cancer cells - Full text - MIT Libraries
M van Erk, E Teuling, Y Staal, S Huybers, P van … - Journal of Carcinogenesis, 2004 - dx.doi.org
... Tables 1 and 2). Upregulated signal transduction genes included STAT3 and STAT5b ...
transcription factor 4 (ATF4) and early growth response 1 (EGR1) (Table 2 ...
Cited by 2 - Web Search - pubmedcentral.nih.gov - carcinogenesis.com - citebase.eprints.org - all 9 versions »
Expression profiling reveals functionally important genes and coordinately regulated signaling … - Full text - MIT Libraries
CN Hahn, ZJ Su, CJ Drogemuller, A Tsykin, SR … - Physiological Genomics, 2005 - physiolgenomics.physiology.org
... the immediate-early genes Fos, JUNB, and EGR1 as well as phospholipase A 2 (PLA2),
signal transducer and activator of transcription 3 (STAT3), and the c-Myc ...
Web Search - physiolgenomics.physiology.org - ncbi.nlm.nih.gov
Central Role of PKCss in Neointimal Expansion Triggered by Acute Arterial Injury - Full text - MIT Libraries
M Andrassy, D Belov, E Harja, YS Zou, M Leitges, … - Circulation Research, 2005 - circresaha.org
... No differences in phospho-Jak2 or phospho-Stat3 were observed between injured ... activation
in mice lacking the zinc finger transplantation factor NGFI-A (EGR1). ...
Cached - Web Search - circres.ahajournals.org - ahavj.ahajournals.org - ncbi.nlm.nih.gov - all 7 versions »
Molecular Profiling of Inflammatory Breast Cancer - Full text - MIT Libraries
I Bieche, F Lerebours, S Tozlu, M Espie, M Marty, … - Clinical Cancer Research, 2004 - clincancerres.aacrjournals.org
... early growth-response genes that code for transcription factors (MYCN and EGR1)
or nonreceptor ... Vellenga E, Kruijer W c-Jun and c-Fos cooperate with STAT3 in IL-6 ...
Web Search - clincancerres.aacrjournals.org - ncbi.nlm.nih.gov
Epidermal growth factor receptor dependence of radiation-induced transcription factor activation in … - Full text - MIT Libraries
GP Amorino, VM Hamilton, K Valerie, P Dent, G … - Mol. Biol. Cell, 2002 - molbiolcell.org
... Stat3 and Egr-1 reporter constructs were generously provided by Dr. Timothy Schaefer ...
C mediates x-ray inducibility of nuclear signal transducers EGR1 and JUN. ...
Cited by 11 - Web Search - molbiolcell.org - intl.molbiolcell.org - pubmedcentral.nih.gov - all 8 versions »
Transcriptional control during mammalian anterior pituitary development - Full text - MIT Libraries
JJ Savage, BC Yaden, P Kiratipranon, SJ Rhodes - Gene, 2003 - www-unix.oit.umass.edu
... 3.2.2. EGR1 Gene inactivation studies have implicated the EGR1 zinc finger
transcription factor in pituitary somatotrope and gonadotrope cell development. ...
Cited by 7 - View as HTML - Web Search - ncbi.nlm.nih.gov
Sustained ERK 1/2 but not STAT 1 or 3 activation is required for thanatophoric dysplasia phenotypes … - Full text - MIT Libraries
N Nowroozi, S Raffioni, T Wang, BL Apostol, RA … - Human Molecular Genetics, 2005 - hmg.oxfordjournals.org
... L09752); Early growth response1 (egr1) [ACTAGAACATCAAGTTGGCTGAAAA] (forward) and
[TTGTTTAAGCAAACACAAGTACGAA ... were used: phospho-Tyr 705 STAT3, phospho-Tyr 694 ...
Web Search - hmg.oxfordjournals.org - hmg.oupjournals.org - ncbi.nlm.nih.gov
Journal of Carcinogenesis - Full text - MIT Libraries
MJ van Erk, E Teuling, YCM Staal, S Huybers, PJ … - Journal of Carcinogenesis, 2004 - bmc.ub.uni-potsdam.de
... EGR1, a transcription fac- tor involved in cell growth regulation and tumor ... and
activator of transcription 3 (acute-phase response factor) STAT3 1.56 1.19 ...
View as HTML - Web Search
Ephrin-B reverse signaling induces expression of wound healing associated genes in IEC-6 intestinal …
C Hafner, S Meyer, I Hagen, B Becker, A Roesch, M … - wjgnet.com
... phosphatase 1; EGFR: Epidermal growth factor receptor; EGR1: Early growth response ...
inhibitor, member 1; SP1: Sp1 transcription factor; STAT3: Signal transducer ...
View as HTML - Web Search - wjgnet.com
Negative cross-talk between hematopoietic regulators: GATA proteins repress PU. - Full text - MIT Libraries
P Zhang, G Behre, J Pan, A Iwama, N Wara-aswapati, … - Blood, 2004 - dx.doi.org
... zinc finger protein EZI enhances nuclear retention and transactivation of STAT3
EMBO J ... of Retroviral Enhancer Mutations in Hematopoietic Cells: SP1/EGR1 and ETS ...
Cited by 120 - Web Search - pnas.org - pubmedcentral.gov - ncbi.nlm.nih.gov - all 5 versions »
State-of-the-Art Review
E ALGAR - JOURNAL OF HEMATOTHERAPY & STEM CELL RESEARCH, 2002 - dx.doi.org
... These may include zinc-finger transcription factors such as EGR1 that have structural ...
by the G-CSF receptor (G-CSFR) and constitutivelyactivated Stat3 (88). ...
Web Search - liebertonline.com - liebertonline.com
The Enigmatic X Gene of Hepatitis B Virus - Full text - MIT Libraries
GFOF HBx, IS HBx, HL CYCLE - J Virol, 2004 - pubmedcentral.nih.gov
... group has confirmed the importance of calcium signaling in HBx activation of STAT3
and MAPK ... factors (ATF/CREB, ATF3, ICERIIγ, c/EBP, NF-IL-6, Egr1, Ets, Oct1 ...
Web Search
The urokinase plasminogen activator receptor (UPAR) is preferentially induced by nerve growth factor … - Full text - MIT Libraries
R Farias-Eisner, L Vician, A Silver, S Reddy, SA … - J Neurosci, 2000 - jneurosci.org
... To be certain that EGF effectively stimulated PC12 cells in this experiment,
the filter was stripped and reprobed for TIS8/EGR1 mRNA. ...
Cited by 18 - Web Search - jneurosci.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The Enigmatic X Gene of Hepatitis B Virus - Full text - MIT Libraries
MJ Bouchard, RJ Schneider - J. Virol, 2004 - jvi.asm.org
... group has confirmed the importance of calcium signaling in HBx activation of STAT3
and MAPK p38 ... factors (ATF/CREB, ATF3, ICERII , c/EBP, NF-IL-6, Egr1, Ets, Oct1 ...
Cited by 1 - Web Search - jvi.asm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genetic heterogeneity of stably transfected cell lines revealed by expression profiling with … - Full text - MIT Libraries
MK Oh, DR Scoles, C Haipek, AD Strand, DH Gutmann, … - Journal of Cellular Biochemistry, 2003 - doi.wiley.com
... reflect the function of transcriptional regulators, such as p53 [Zhao et al., 2000],
EGR1 [Svaren et al ... Rac and STAT3/5 [Pelton et al., 1998; Scoles et al., 2002 ...
Web Search - cedars-sinai.edu - ncbi.nlm.nih.gov
Transcription of the bone sialoprotein gene is stimulated by v-Src acting through an inverted CCAAT … - Full text - MIT Libraries
RH Kim, J Sodek - Cancer Res, 1999 - intl-cancerres.aacrjournals.org
... to modulate gene expression through serum-responsive elements of the Egr1/TIS8 gene
(29 ... Among the members of this family, Stat3, which is activated by various ...
Cited by 21 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Aging does not reduce the hepatocyte proliferative response of mice to the primary mitogen TCPOBOP - Full text - MIT Libraries
GM Ledda-Columbano, M Pibiri, C Cossu, F Molotzu, … - Hepatology, 2004 - doi.wiley.com
... factors AP1, nuclear factor (NF)- B STAT3, and C/EBP; increased expression of immediate
early proteins c-fos, c-jun, c- myc, LRF-1, and EGR1; or release of the ...
Web Search - ncbi.nlm.nih.gov
Strong nuclear factor-kB–DNA binding parallels cyclooxygenase-2 gene transcription in aging and in … - Full text - MIT Libraries
WJ Lukiw, NG Bazan - J Neurosci Res, 1998 - doi.wiley.com
... binding sites that show homology to the core consensus se- quences for AP1, AP2,
Egr1, hypoxia inducible factor (HIF), NFIL-6, NF- B, STAT1, and STAT3 (Sen and ...
Cited by 58 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Bacterial pathogens modulate an apoptosis differentiation program in human neutrophils - Full text - MIT Libraries
SD Kobayashi, KR Braughton, AR Whitney, JM Voyich, … - Proceedings of the National Academy of Sciences, USA, 2003 - pnas.org
... within 90 min after phagocytosis (Table 1). For example, only EGR1 and EGR2 ... play
key roles in IFN signaling and cell fate, including STAT1, STAT3, STAT5B, STAT6 ...
Cited by 22 - Web Search - 171.66.122.165 - pubmedcentral.nih.gov - math.unm.edu - all 9 versions »
Neuroinflammatory signaling upregulation in Alzheimer’s disease
WJ Lukiw, NG Bazan - Neurochem. Res, 2000 - kluweronline.com
... factor kappa B), PPRE (peroxisome proliferator responsive element), STAT1, STAT3
(signal transducers ... motifs of limi- ted homology for the TFs Egr1 (zif268) and ...
Cited by 36 - Web Search - springerlink.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Analysis of prolactin-modulated gene expression profiles during the Nb 2 cell cycle using … - Full text - MIT Libraries
C Bole-Feysot, E Perret, P Roustan, B Bouchard, PA … - Genome Biology, 2000 - biomedcentral.com
... Zif268 = EGR1 U75398 2 UN GA G1 G1/S G2 ... D, E and F are examples of the results obtained
with ganglioside synthase GD3, EGR-1, FAK p125 and Stat3, respectively. ...
Cited by 9 - View as HTML - Web Search - dx.doi.org - bmc.ub.uni-potsdam.de - genomebiology.com - all 10 versions »
Differential effect of glucose deprivation on MAPK activation in drug sensitive human breast …
AK Gupta, YJ Lee, SS Galoforo, CM Berns, AA … - Mol Cell Biochem, 1997 - springerlink.com
... The SIE interacts with activated Stat3, a member of the STAT (signal transducer
and ... C mediates x-ray inducibility of nu- clear signal transducers EGR1 and JUN. ...
Cited by 9 - Web Search - kluweronline.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
WL Blalock, C Weinstein-Oppenheimer, F Chang, PE Hoyle, XY Wang 3, PA Algate 4, RA Franklin, SM …
LS Steelman, JA McCubrey - Leukemia, 1999 - nature.com
Page 1. Leukemia (1999) 13, 1109–1166 © 1999 Stockton Press All rights reserved
0887-6924/99 $12.00 http://www.stockton-press.co.uk/leu REVIEW ...
Web Search
MafB is an inducer of monocytic differentiation - Full text - MIT Libraries
LM Kelly, U Englmeier, I Lafon, MH Sieweke, T Graf - The EMBO Journal, 2000 - embojournal.npgjournals.com
... Even though the transcription factors Egr-1, Stat3, Gbx2 and PU.1 have also been
implicated in monocytic differentiation (Nguyen et al., 1993; Nakajima et al ...
Cited by 33 - Web Search - nature.com - emboj.org - pubmedcentral.nih.gov - all 7 versions »
Molecular characterization of rat gastric mucosal response to potent acid inhibition - Full text - MIT Libraries
KG Noersett, A Laegreid, M Langaas, S Woerlund, R … - Physiological Genomics, 2005 - physiolgenomics.physiology.org
... The transcription factor early growth response gene 1 (Egr1), also downregulated
in ... reported that its downregulation inhibits repression of Stat3 activity and ...
Cited by 1 - Web Search - physiolgenomics.physiology.org - ncbi.nlm.nih.gov
Genomics of the periinfarction cortex after focal cerebral ischemia
A Lu, Y Tang, R Ran, JF Clark, BJ Aronow, FR Sharp - J Cereb Blood Flow Metab, 2003 - nature.com
Page 1. Genomics of the Periinfarction Cortex After Focal Cerebral Ischemia
*Aigang Lu, *Yang Tang, *Ruiqiong Ran, *Joseph F. Clark ...
Cited by 18 - View as HTML - Web Search - nature.com - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Concurrent opposite effects of an inhibitor of histone deacetylases, Trichostatin-A, on the …
FJ Davis, JB Pillai, M Gupta, MP Gupta - ajpheart.physiology.org
... DNA probe. The probe α-MHC gene EGR1 binding site sense-strand is, 5’GTG GGG
GTG 3’ (13). ... EGR1 binding sites, but not the mutant sites. ...
Web Search
| |
©2005 Google