![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 167 for STAT3 and TBP. (0.68 seconds) |
Analysis of Signal Transducer and Activator of Transcription 3 (Stat 3) Pathway in Multiple Myeloma
L Quintanilla-Martinez, M Kremer, K Specht, J … - Signal - ajp.amjpathol.org
... The Stat3/TBP ratio in reactive tissues Table 1. Sequence of TaqMan Primers and
Probes Used in This Study ... Stat3/TBP ratios below 1.79 (mean 5 SD) ...
Cited by 10 - Web Search - ajp.amjpathol.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell lymphoma - Full text - MIT Libraries
C Brender, M Nielsen, K Kaltoft, G Mikkelsen, Q … - Blood, 2001 - bloodjournal.org
... 6. Decreased SOCS-3 mRNA expression in MyLa 2000 cells stably transfected with dominant
negative STAT3. ... TBP-specific primers were used as internal standard. ...
Cited by 25 - Web Search - dx.doi.org - bloodjournal.org - ncbi.nlm.nih.gov - all 5 versions »
Stat3 and Tumor Cell Proliferation
N Schick - unibas.ch
Page 1. Stat3 and Tumor Cell Proliferation Inauguraldissertation zur Erlangung der
Würde eines Doktors der Philosophie ... 42 4.2 Stat2 42 4.3 Stat3 42 3 Page 5. ...
View as HTML - Web Search - pages.unibas.ch - unibas.ch - pages.unibas.ch
PLENARY SESSIONS ABSTRACTS
IM Kerr, B Lillemeier, B Strobl, H Is’harc, A … - dx.doi.org
... While both SOCS-1 and SOCS-3 could inhibit STAT3 activation, SOCS-1 ... and transcriptional
induction can proceed independently of the TATA-binding protein, TBP. ...
Web Search - liebertonline.com - liebertonline.com
Meeting Report Second International Conference on Signal Transduction, Croatia May 2000 - Full text - MIT Libraries
Z Dembic - Scandinavian Journal of Immunology, 2000 - blackwell-synergy.com
... of cell growth and may curb the growth of malignant cells, whereas the STAT3 deficiency
stops ... binding of TF II D to the TATA box via the TAF and TBP proteins. ...
Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The Roles of Inflammation, STAT Transcription Factors, and Nerve Growth Factor in Viral Reactivation …
MA Liebert, I Pp - DNA AND CELL BIOLOGY, 2002 - dx.doi.org
... Phosphoserine–STAT3, another ac ... TG nuclear extracts with and without STAT1 antibodies,
and TG nuclear extracts with anti-TATA binding protein (TBP) antibodies ...
Web Search - liebertonline.com - ncbi.nlm.nih.gov - all 4 versions » - Get it from MIT Libraries
Regulatory elements of hepatitis B virus transcription - Full text - MIT Libraries
N Moolla, M Kew, P Arbuthnot - Journal of Viral Hepatitis, 2002 - blackwell-synergy.com
... A Sp1 site overlaps the TBP site [18]. ... HNF-3, and possibly NF1, interact
cooperatively with STAT3 and augment enhancer I function. ...
Cited by 6 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Chromatin-remodelling factor BRG 1 selectively activates a subset of interferon-< img border='0' src … - Full text - MIT Libraries
M Huang, F Qian, Y Hu, C Ang, Z Li, Z Wen - Nature Cell Biology, 2002 - nature.com
... that serine phosphorylation has no influence on DNA binding of Stat1 and Stat3. ... N.
& Levy, DE IFN-stimulated transcription through a TBP-free acetyltransferase ...
Web Search
Signalling: Stats: transcriptional control and biological impact - Full text - MIT Libraries
DE Levy, JE Darnell - Nature Reviews Molecular Cell Biology, 2002 - nature.com
... 15. Collum, RG, Brutsaert, S., Lee, G. & Schindler, C. A Stat3-interacting protein
(StIP1) regulates cytokine signal transduction. Proc. Natl Acad. Sci. ...
Cited by 166 - Web Search - jhcourse.jhu.edu - medicine.facmed.utoronto.ca - qb.fcen.uba.ar - all 14 versions »
Gene Expression Levels of Cytokines in Peritoneal Washings from Patients with Gastric Cancer - Full text - MIT Libraries
M Ikeguchi, S Matsumoto, D Murakami, S Kanaji, S … - Tumor Biology, 2004 - content.karger.com
... CT = CT (TBP) – CT (target ... This homodimer activates Janus kinase (JAK) and also
activates signal transducers and activators of transcrip- tion 3 (STAT3). ...
Cited by 1 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
Androgen receptor involvement in the progression of prostate cancer
H Suzuki, T Ueda, T Ichikawa, H Ito - Endocrine-Related Cancer, 2003 - journals.endocrinology.org
... up-regulation of AR-regulated genes such as PSA by ligand-independent activation
of AR, which is stimulated by both phosphorylation of STAT3 and MAPK. ... TAF TBP ...
Cited by 12 - View as HTML - Web Search - erc.endocrinology-journals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Interferon-Alpha Induces Transient Suppressors of Cytokine Signalling Expression in Human T Cells
C Brender, M Nielsen, C Rö pke, MH Nissen, A … - Experimental and Clinical Immunogenetics, 2001 - content.karger.com
... using a phosphorimager and SOCS expression was calculated relative to TBP expression ...
K, Mikkelsen G, Zhang Q, Wasik MA, Billestrup N, Ødum N: STAT3 me- diated ...
Cited by 9 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Mutationen des Wachstumsfaktor-Rezeptors Flt3 bei Akuter Myeloischer Leukaemie - Full text - MIT Libraries
L Reporter-Assays - Dtsch med Wochenschr, 2002 - thieme-connect.com
... unabhängigen Untersuchungen bestätigt (Vergleich zur Expression von TBP,
Microarray-Experiment, Daten nicht gezeigt). Abb. 1 Aktivierung von STAT3 und STAT5 ...
Web Search
IL-6-induced survival of colorectal carcinoma cells is inhibited by butyrate through down-regulation … - Full text - MIT Libraries
H Yuan, FJ Liddle, S Mahajan, DA Frank - Carcinogenesis, 2004 - carcin.oupjournals.org
... to CD95 (19) and tyrosine phosphorylated STAT1 (20) and STAT3 (21) were ... CCA AGT CTG
CAA CTG CAA CA; TATA binding protein (TBP), CCGTGAATCTTGGCTGTAAACTTG and ...
Web Search - carcin.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
[CITATION] Unsubscribed Journal FEBS Letters
K Turpaev, R Hartmann… - FEBS Letters,, 1999
Cited by 1 - Web Search - Get it from MIT Libraries
The vesicular stomatitis virus matrix protein inhibits glycoprotein 130-dependent STAT activation - Full text - MIT Libraries
L Terstegen, P Gatsios, S Ludwig, S Pleschka, W … - J. Immunol, 2001 - jimmunol.org
... Functional interaction of STAT3 transcription factor with the cell cycle inhibitor ...
independent of phosphorylation of TATA-binding protein (TBP) or association ...
Cited by 4 - Web Search - biomat-nawuwi.izkf.rwth-aachen.de - 134.130.13.185 - ncbi.nlm.nih.gov - all 7 versions »
Transcriptional Regulation by a DNA-associated Form of Cyclin D1 - Full text - MIT Libraries
F Bienvenu, B Barre, S Giraud, S Avril, O Coqueret - Mol Biol Cell, 2005 - molbiolcell.org
... is tempting to speculate that cyclin D1 disrupts contacts between STAT3 and essential ...
PCAF has been reported to be associated with the TBP-associated factors ...
Web Search - pubmedcentral.nih.gov - molbiolcell.org - ncbi.nlm.nih.gov
Deacetylase activity is required for recruitment of the basal transcription machinery and … - Full text - MIT Libraries
A Rascle, JA Johnston, B Amati - Mol Cell Biol, 2003 - mcb.asm.org
... Improper regulation, especially constitutive activation of STAT5 and STAT3, directly
contributes to ... sc-899; 2 µg), and TATA-binding protein (TBP; SI-1; Santa ...
Cited by 19 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
Different mechanisms of cyclin D1 overexpression in multiple myeloma revealed by fluorescence in … - Full text - MIT Libraries
K Specht, E Haralambieva, K Bink, M Kremer, S … - Blood, 2004 - bloodjournal.org
... D1 mRNA were found in all samples (median cyclin D1/TBP ratio 31.9 ... and activator
of transcription 3 (Stat 3) pathway in multiple myeloma: Stat3 activation and ...
Cited by 9 - Web Search - dx.doi.org - bloodjournal.org - ncbi.nlm.nih.gov - all 6 versions »
A proteome analysis of conditioned media from human neonatal fibroblasts used in the maintenance of … - Full text - MIT Libraries
ABJ Prowse, LR McQuade, KJ Bryant, DD Van Dyk, BE … - PROTEOMICS, 2005 - doi.wiley.com
... mES) cells involving the transcription factors nanog [8, 9], Oct 4, and Stat3 [10,
11 ... tributylphosphine (TBP), 2% w/v CHAPS, 2% w/v sulfobe- taine 3–10, 0.2% v ...
Web Search - ncbi.nlm.nih.gov
Cytokine signaling in 2002: new surprises in the Jak/Stat pathway - Full text - MIT Libraries
JJ O'Shea, M Gadina, RD Schreiber, M Immunology, I … - Cell, 2002 - courses.vcu.edu
... been identified: Stat1, Stat2, Stat3, Stat4, Stat5a, Stat5b, and Stat6 (Figure 3);
again, large-scale sequencing ef- ... Thus, Stat3 and Stat5 function in a man- ...
Cited by 183 - View as HTML - Web Search - biochem.wisc.edu - ncbi.nlm.nih.gov - all 4 versions »
Molecular Profiling of Inflammatory Breast Cancer - Full text - MIT Libraries
I Bieche, F Lerebours, S Tozlu, M Espie, M Marty, … - Clinical Cancer Research, 2004 - clincancerres.aacrjournals.org
... show the abundance of the target relative to the endogenous control (TBP), to normalize
the ... D, Vellenga E, Kruijer W c-Jun and c-Fos cooperate with STAT3 in IL ...
Web Search - clincancerres.aacrjournals.org - ncbi.nlm.nih.gov
Activation of the Jak 3 pathway and myeloid differentiation
J Mangan, EP Reddy - Leukemia & Lymphoma, 2005 - dx.doi.org
... associated factors, TAF110, as well as TATA binding protein (TBP), both important ...
In light of the evidence implicating STAT3 in regulation of Jak3 transcription ...
Web Search - taylorandfrancis.metapress.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
STAT 1 binds to the herpes simplex virus type 1 latency-associated transcript promoter
J Kriesel, B Jones, K Dahms, SL Spruance 2 - Journal of NeuroVirology, 2004 - taylorandfrancis.metapress.com
... The other STATs studied, STAT3 and STAT5b, did not bind in this re- gion ... antibodies,
and TG nuclear extracts with anti–TATA binding protein (TBP) antibodies. ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
A unique ISRE, in the TATA-less human Isg20 promoter, confers IRF-1-mediated responsiveness to both … - Full text - MIT Libraries
CR Guidelines - Nucleic Acids Research, 2000 - nar.oupjournals.org
... The antibodies against Stat1, Stat2, Stat3, IRF-1 or IRF-2 used for the supershift ...
be initiated by the recruitment of the TATA-box binding protein (TBP) by a GC ...
Cited by 20 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
Purification and Characterization of the Human Elongator Complex - Full text - MIT Libraries
NA Hawkes, G Otero, GS Winkler, N Marshall, ME … - J Biol Chem, 2002 - jbc.org
... in vitro with a minimal set of general transcription factors, such as TBP, TFIIB,
TFIIF ... activator signal transducer and activator of transcription 3 (STAT3) (10 ...
Cited by 31 - Web Search - jbc.org - ncbi.nlm.nih.gov
Anti-Allergic Action of Glucocorticoids: Comparison with Immuno-suppressive and Anti-Inflammatory …
H Yoshikawa, K Tasaka - ingentaconnect.com
... in term ediary factor 2; Pol II: RNA polymerase II; TBP: TATA binding protein; TAFs:
TBP-associated factors ... STAT3 acts as a coactivator of GR signaling [53]. ...
Web Search
The Transcription Network Regulating Melanocyte Development and Melanoma - Full text - MIT Libraries
KW Vance, CR Goding - Pigment Cell Research, 2004 - blackwell-synergy.com
... Interestingly, Mitf appears to cooperate with STAT3 in transformation of 3T3 cells ...
Cell type-specific TBP-associated factors (TAFs) have been observed in other ...
Cited by 9 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
STAT5 and Oct-1 form a stable complex that modulates cyclin D1 expression - Full text - MIT Libraries
S Magne, S Caron, M Charon, MC Rouyez, I Dusanter- … - Mol. Cell. Biol, 2003 - pubmedcentral.nih.gov
... similarly, only the binding of STAT5, but not STAT1 or STAT3, to GAS2 ... 1 was recently
shown to directly facilitate TATA-binding protein (TBP) recruitment near a ...
Cited by 4 - Web Search - dx.doi.org - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Epigenetic control of neural stem cell fate
J Hsieh, FH Gage - Curr. Opin. Genet. Dev, 2004 - utsouthwestern.edu
... receptor corepressor Ngn1 neurogenin 1 NSC neural stem cells STAT3 signal transducer ...
Ac, acetylation; TAF, TBP-associated factor; TBP, TATA-binding protein. ...
Cited by 6 - View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
BASIC MECHANISMS OF GLUCOCORTICOID RECEPTOR ACTION IN NONINFLAMMATORY CELLS
BM Necela, JA Cidlowski - pats.atsjournals.org
... of the STAT family (STAT1, STAT5, and STAT3) and synergistically ... transcriptional
machinery, including TATA box-binding protein (TBP), TBP-associated factors ...
Web Search
The Enigmatic X Gene of Hepatitis B Virus - Full text - MIT Libraries
GFOF HBx, IS HBx, HL CYCLE - J Virol, 2004 - pubmedcentral.nih.gov
... the RPB5 subunit of RNA polymerases, and the TATA-binding protein (TBP) (23, 43 ... Src
kinases prevents HBx activation of transcription by AP-1 and STAT3, as well ...
Web Search
The Enigmatic X Gene of Hepatitis B Virus - Full text - MIT Libraries
MJ Bouchard, RJ Schneider - J. Virol, 2004 - jvi.asm.org
... the RPB5 subunit of RNA polymerases, and the TATA-binding protein (TBP) (23, 43 ... Src
kinases prevents HBx activation of transcription by AP-1 and STAT3, as well ...
Cited by 1 - Web Search - jvi.asm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Signal transducer and activator of transcription(STAT) signalling and T-cell lymphomas - Full text - MIT Libraries
TJ Mitchell, S John - Immunology, 2005 - blackwell-synergy.com
... cytokine-induced STAT activation. The mammalian STAT family comprises Stat1,
Stat2, Stat3, Stat4, Stat5a, Stat5b and Stat6. 20 The two ...
Web Search - ingentaconnect.com - immuneweb.xxmc.edu.cn - ncbi.nlm.nih.gov
Transcription factors
V GUASCONI, Y Hakima, A Slimane - caroll.vjf.cnrs.fr
... Stat3 as an oncogene. Cell. 1999 Aug 6;98(3):295-303. ... Kim Y, Geiger JH, Hahn S, Sigler
PB. Crystal structure of a yeast TBP/TATA-box complex. Nature. ...
Cached - Web Search
A novel transcriptional regulatory region within the core promoter of the hepatocyte growth factor … - Full text - MIT Libraries
JG Jiang, R Zarnegar - Mol Cell Biol, 1997 - mcb.asm.org
... Additional competitors (ie, binding sites for various factors known to be induced
by cytokines), including AP-1, AP-2, IL-6RE, NF- B, and Stat3, were also ...
Cited by 20 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Epigenetic Profiling of Cutaneous T-Cell Lymphoma: Promoter Hypermethylation of Multiple Tumor … - Full text - MIT Libraries
R van Doorn, WH Zoutman, R Dijkman, X Renee, S … - Journal of Clinical Oncology, 2005 - jco.org
... transforming growth factor beta receptors, p16, constitutive activity of STAT3,
and chromosomal ... factor 6 (CPSF6) and TATA-box-binding protein (TBP) were used ...
Cited by 1 - Web Search - dx.doi.org - jco.org - ncbi.nlm.nih.gov
Regulation of transcription factor function by phosphorylation - Full text - MIT Libraries
AJ Whitmarsh, RJ Davis - Cell. Mol. Life Sci, 2000 - springerlink.com
... p300 binds to both STAT3 and SMAD1 and coordinates the synergis- tic response to ...
TFIID is composed of the TATA- binding protein (TBP) and many TBP-associated ...
Cited by 50 - Web Search - ncbi.nlm.nih.gov
Chromatin acetylation and remodeling at the Cis promoter during STAT 5-induced transcription - Full text - MIT Libraries
A Rascle, E Lees - Nucleic Acids Research, 2003 - nar.oupjournals.org
... As a control for specificity, STAT3 expression was shown to be unaffected following
STAT5 ... within minutes of IL-3 stimulation, closely followed by TBP and RNA ...
Cited by 3 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
Proteomic analysis of pancreatic ductal carcinoma cells treated with 5-aza-2’-deoxycytidine - Full text - MIT Libraries
M Donadelli, M Palmieri, E Missiaglia, M Hamdan, A … - Electrophoresis, 2003 - doi.wiley.com
... Urea, thiourea, CHAPS, iodoacetamide (IAA), tributyl- phosphine (TBP), and sodium
dodecyl sulfate (SDS) were obtained from Fluka Chemie (Buchs, Switzerland). ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Transcription of the bone sialoprotein gene is stimulated by v-Src acting through an inverted CCAAT … - Full text - MIT Libraries
RH Kim, J Sodek - Cancer Res, 1999 - intl-cancerres.aacrjournals.org
... short domains adjacent to their histone fold motifs for association with TBP basic
residues ... Tay A., Guy GR, Tan YH Activation and association of Stat3 with Src ...
Cited by 21 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
[CITATION] The Ins and Outs of STAT1 Nuclear Transport
KM McBride, NC Reich - Sci. STKE, 2003
... RK Ho, JH Postlethwait, LI Zon, AF Wilks, Zebrafish stat3 is expressed in ... N. Tanese,
DE Levy, IFN-stimulated transcription through a TBP-free acetyltransferase ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Molecular basis of Stat1 and PU. 1 cooperation in cytokine-induced Fc {gamma} receptor I promoter …
S Aittomaki, J Yang, EW Scott, MC Simon, O … - Int. Immunol. 16, 2004 - intimm.oupjournals.org
... is the lack of any association between Stat1 and either TBP or RNA ... Maximal activation
of transcription by Stat1 and Stat3 requires both tyrosine and serine ...
Cited by 1 - Web Search - intimm.oupjournals.org - intimm.oupjournals.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Geldanamycin, a heat shock protein 90-binding agent, disrupts Stat 5 activation in IL-2-stimulated … - Full text - MIT Libraries
W Xu, F Yu, M Yan, L Lu, W Zou, L Sun, Z Zheng, X … - Journal of Cellular Physiology, 2004 - doi.wiley.com
... in the construct containing the major promoter region of the TNF-b gene (pGL3B-
TbP). ... For example, it was demonstrated that Stat3 exists in the form of high ...
Web Search - sibcb.sibs.ac.cn - sibcb.ac.cn - ncbi.nlm.nih.gov - all 5 versions »
Microarray analysis of gene expression in human donor sclera - Full text - MIT Libraries
TL Young, GS Scavello, PC Paluru, JD Choi, EF … - Mol Vis, 2004 - molvis.org
... DEK 6p23 NM_021145 cyclin D binding myb-like DMTF1 7q21 transcription factor 1
NM_001938 down-regulator of transcription DR1 1p22.1 1, TBP-binding (negative ...
Cited by 3 - View as HTML - Web Search - molvis.org - scavello.net - ncbi.nlm.nih.gov
Mechanisms of Type I interferon cell signaling and STAT-mediated transcriptional responses - Full text - MIT Libraries
JF Lau, CM Horvath - Mt Sinai J Med, 2002 - mssm.edu
... TAD: transcriptional activation domain TAF: TBP-associated factor TBP: TATA-binding ...
quence alignment and crystallographic analy- ses of STAT1, STAT3, and STAT4 ...
Cited by 8 - View as HTML - Web Search - ncbi.nlm.nih.gov
Identification of Transcriptional Networks during Liver Regeneration - Full text - MIT Libraries
P White, JE Brestelli, KH Kaestner, LE Greenbaum - J Biol Chem, 2005 - jbc.org
... the activation of preexisting transcription factors, including NF B, Stat3, AP-1 ...
were normalized to the expression of the housekeeping gene TBP (confirmed not ...
Cited by 3 - Web Search - jbc.org - ncbi.nlm.nih.gov
A role of the TATA box and the general co-activator hTAF II 130/135 in promoter-specific trans- …
M Johannessen, PA Olsen, R Soerensen, B Johansen, … - J Gen Virol, 1887 - jgv.sgmjournals.org
... element-binding protein (CREB), AP-1, NF B, p53, Sp1, STAT3 and HOX11 ... herpes simplex
virus) induce transcription by enhancing or stabilizing TBP binding to the ...
Cited by 3 - Web Search - vir.sgmjournals.org - jgv.sgmjournals.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
CLOCK, an essential pacemaker component, controls expression of the circadian transcription factor … - Full text - MIT Libraries
JA Ripperger, LP Shearman, SM Reppert, U Schibler - Genes Dev, 2000 - genesdev.org
... The RNA samples were hybridized to specific probes for Dbp-lacZ mRNA and
tbp mRNA. tbp mRNA served as an internal control for a ...
Cited by 121 - Web Search - invivo.caltech.edu - molbio.unige.ch - pubmedcentral.nih.gov - all 6 versions »
p 38 Mitogen-activated Protein Kinase Regulates Interleukin-4-induced Gene Expression by Stimulating … - Full text - MIT Libraries
M Pesu, S Aittomaeki, K Takaluoma, A Lagerstedt, O … - Journal of Biological Chemistry - jbc.org
... contain the conserved MAPK Ser-phosphorylation motif found in STAT1, STAT3, and
STAT4. ... the possible role of p38 MAPK in regulation of the TBP-STAT6 interaction ...
Cited by 5 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
|
©2005 Google