![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 331 for TAL1 and LMO2. (0.21 seconds) |
Lmo 2 and Scl/Tal 1 convert non-axial mesoderm into haemangioblasts which differentiate into … - Full text - MIT Libraries
M Gering, Y Yamada, TH Rabbitts, RK Patient - Development, 2003 - dev.biologists.org
... This restriction correlates well with activation of gata1 transcription and
co-injection of gata1 mRNA along with scl/tal1 and lmo2 induces erythropoiesis more ...
Cited by 10 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters thymocyte development and potentiates T … - Full text - MIT Libraries
RC Larson, I Lavenir, TA Larson, R Baer, AJ Warren … - Cancer Res, 2005 - embojournal.npgjournals.com
... The LMO2 and TAL1 genes were first identified via chromosomal translocations and
later found to encode proteins that interact during normal erythroid ...
Cited by 86 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
[CITATION] The Lim-only protein Lmo2 is a bridging molecular assembling an erythroid, DNA-binding complex which … - Full text - MIT Libraries
IA Wadman, H Osada, GG Grutz, AD Agulnick, H … - EMBO J, 1997
Cited by 59 - Web Search
A complex linkage in the developmental pathway of endothelial and hematopoietic cells
SI Nishikawa - Curr Opin Cell Biol, 2001 - cbi.pku.edu.cn
... While Tal1 and LMO2 are expressed in early progenitors with the potential to generate
ECs and HPCs, the develop- ment of ECs and subsequent formation of the ...
Cited by 19 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
TAL1 and LIM-only proteins synergistically induce retinaldehyde dehydrogenase 2 expression in T-cell … - Full text - MIT Libraries
Y Ono, N Fukuhara, O Yoshie - Mol. Cell. Biol, 1998 - mcb.asm.org
... Targeted-disruption experiments revealed that both TAL1 and LMO2 are essential for
embryogenesis, as mutant mice die at embryonic day 9.5 due to the absence of ...
Cited by 39 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
The LIM Protein RBTN2 and the Basic Helix-Loop-Helix Protein TAL1 are Present in a Complex in … - Full text - MIT Libraries
VE Valge-Archer, H Osada, AJ Warren, A Forster, J … - Proceedings of the National Academy of Sciences - pnas.org
... and RK Patient Lmo2 and Scl/Tal1 convert non-axial mesoderm into haemangioblasts
which differentiate into endothelial cells in the absence of Gata1 Development ...
Cited by 93 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
The T cell leukemia LIM protein Lmo2 is necessary for adult mouse hematopoiesis - Full text - MIT Libraries
Y Yamada, AJ Warren, C Dobson, A Forster, R … - Physiol Genomics, 2004 - dx.doi.org
... and RK Patient Lmo2 and Scl/Tal1 convert non-axial mesoderm into haemangioblasts
which differentiate into endothelial cells in the absence of Gata1 Development ...
Cited by 78 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
The LIM-only protein Lmo 2 is a bridging molecule assembling an erythroid, DNA-binding complex which … - Full text - MIT Libraries
IA Wadman, H Osada, GG Grutz, AD Agulnick, H … - The EMBO Journal, 1997 - embojournal.npgjournals.com
... similar to that derived from the anti-Lmo2 CASTing (Figure 1A), suggesting that
a complex consisting of at least TAL1 and Lmo2 binds to the E-box-GATA motif. ...
Cited by 161 - Web Search - emboj.org - nature.com - ncbi.nlm.nih.gov - all 7 versions »
Positive and Negative Transcriptional Control by the TAL1 Helix-Loop-Helix Protein - Full text - MIT Libraries
H Hsu, I Wadman, JT Tsan, R Baer - Proceedings of the National Academy of Sciences - pnas.org
... and RK Patient Lmo2 and Scl/Tal1 convert non-axial mesoderm into haemangioblasts
which differentiate into endothelial cells in the absence of Gata1 Development ...
Cited by 34 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Identification of a TAL1 target gene reveals a positive role for the LIM domain-binding protein Ldb1 … - Full text - MIT Libraries
Z Xu, S Huang, LS Chang, AD Agulnick, SJ Brandt - Mol Cell Biol, 2003 - pubmedcentral.nih.gov
... Two of these transcriptional regulators, TAL1 and LMO2, were initially identified
from their involvement by chromosomal rearrangements in T-cell acute ...
Cited by 9 - Web Search - dx.doi.org - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
New insights into erythropoiesis
MJ Koury, ST Sawyer, SJ Brandt - Curr Opin Hematol, 2002 - co-hematology.com
... Commitment of hematopoietic cells to the erythroid lineage involves the actions
of several transcription factors, including TAL1, LMO2, and GATA-2. The ...
Cited by 24 - Web Search - co-hematology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The oncogenic T cell LIM-protein Lmo 2 forms part of a DNA-binding complex specifically in immature … - Full text - MIT Libraries
GG Grutz, K Bucher, I Lavenir, T Larson, R Larson, … - The EMBO Journal, 1998 - embojournal.npgjournals.com
... 1, whose functions seem to be restricted to the erythroid (Pevny et al., 1991 )
and megakaryocyte lineage (Shivdasani et al., 1997 ), Tal1 and Lmo2 seem to ...
Cited by 30 - Web Search - nature.com - emboj.org - pubmedcentral.nih.gov - all 7 versions »
[CITATION] The LIM-only protein Lmo2 is a bridging molecule assemblingan erythroid, DNA-binding complex which … - Full text - MIT Libraries
IA Wadman, H Osada, GG Grutz, AD Agulnick, H … - EMBO J, 1997
Cited by 3 - Web Search
Formation of in vivo Complexes Between the TAL1 and E2A Polypeptides of Leukemic T Cells - Full text - MIT Libraries
H Hsu, I Wadman, R Baer - Proceedings of the National Academy of Sciences - pnas.org
... The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid, DNA-binding
complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins EMBO J ...
Cited by 65 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
The Tal1 oncoprotein inhibits E47-mediated transcription - Full text - MIT Libraries
ST Park, XH Sun - J Biol Chem, 1998 - jbc.org
... Coexpression of Tal1 and LMO1 or LMO2 in T cells appears to enhance the ability
of Tal1 to activate transcription of a reporter gene driven by multiple copies ...
Cited by 33 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
[CITATION] Activation of the T-cell oncogene LMO2 after gene therapy for X-linked severe combined … - Full text - MIT Libraries
MP McCormack, TH Rabbitts - N. Engl. J. Med, 2004
... Panel A), 33-35 a distinct complex of Lmo2, Tal1 (or Scl), E47, and Ldb1
was found in the leukemic T cells of Lmo2 transgenic mice. ...
Cited by 17 - Web Search - frontiers-in-genetics.org - lsic.ucla.edu - ncbi.nlm.nih.gov - all 7 versions »
The oncogenic LIM-only transcription factor Lmo2 regulates angiogenesis but not vasculogenesis in … - Full text - MIT Libraries
Y Yamada, R Pannell, A Forster, TH Rabbitts - EMBO J, 2004 - dx.doi.org
... and RK Patient Lmo2 and Scl/Tal1 convert non-axial mesoderm into haemangioblasts
which differentiate into endothelial cells in the absence of Gata1 Development ...
Cited by 25 - Web Search - pnas.org - pubmedcentral.nih.gov - invivo.caltech.edu - all 7 versions »
The LIM-domain binding protein Ldb1 and its partner LMO2 act as negative regulators of erythroid … - Full text - MIT Libraries
JE Visvader, X Mao, Y Fujiwara, K Hahm, SH Orkin - Proc Natl Acad Sci USA, 1997 - dx.doi.org
... S. Huang, LS Chang, AD Agulnick, and SJ Brandt Identification of a TAL1 Target Gene ...
for the recognition of ldb1 by the N-terminal LIM domains of LMO2 and LMO4 ...
Cited by 52 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Expression of alpha4-integrin defines the earliest precursor of hematopoietic cell lineage diverged … - Full text - MIT Libraries
M Ogawa, M Kizumoto, S Nishikawa, T Fujimoto, H … - Blood, 1999 - bloodjournal.org
... Different dilutions of cDNA prepared from sorted cells were subjected to PCR
amplification specific for Gata1, Gata2, Tal1, Lmo2, Myb, and Gapd transcripts. ...
Cited by 35 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Recombination at chromosomal sequences involved in leukaemogenic rearrangements is differentially … - Full text - MIT Libraries
GS Boehden, A Restle, R Marschalek, C Stocking, L … - Carcinogenesis, 2004 - carcin.oupjournals.org
... cis-regulatory sequences on recombination, we adapted our SV40 based model system
to the analysis of correspondingly selected bcrs from the TAL1, LMO2, RAR? ...
Cited by 1 - Web Search - carcin.oxfordjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 8 versions »
Age-related phenotypic and oncogenic differences in T-cell acute lymphoblastic leukemias may reflect … - Full text - MIT Libraries
V Asnafi, K Beldjord, M Libura, P Villarese, C … - Blood, 2004 - bloodjournal.org
... Conversely, of the 30 TAL1 + -lineage T-ALLs analyzed for all 3 transcripts, 19
expressed only TAL1,8 TAL1, and LMO1 and only 3 TAL1 and LMO2. ...
Cited by 3 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Table IV. Primers
LMOSI GGCCGTCGACATCCGTGCACCGAAATTATTGCTGGG, MI … - intl.jem.org
... Sequence (5'-3'). LMO2, SalI, GGCCGTCGACATCCGTGCACCGAAATTATTGCTGGG. TAAGACAATACTGTG. ...
TCACACTGTGAC. TAL1, MluI, AGGAACGCGTCCAAACACCTGCAG. SalI, CTTCGTCGACACCGTTTCCACCG ...
Web Search
[CITATION] Lmo2 and Scl/Tal1 convert non-axial mesoderm into haemangioblasts which differentiate...
S In, PST Access, S Up
Web Search
Structure and function of the SCL/TAL-1 containing transcriptinal complexes in erythropoiesis and …
L Maouche-Chretien - john-libbey-eurotext.fr
... Les souris doubles transgéniques TAL1/Lmo2 développent des tumeurs plus rapidement
que les souris simples transgéniques TAL1 ou Lmo2, ce qui suggère une ...
Cached - Web Search - john-libbey-eurotext.fr
Transcriptional control of fetal liver hematopoiesis: dominant negative effect of the overexpression …
T Terano, Y Zhong, S Toyokuni, H Hiai, Y Yamada - Exp Hematol, 2005 - ncbi.nlm.nih.gov
... MATERIALS AND METHODS: Protein interactions of LIM-modified LMO2 constructs with
TAL1, LDB1, and GATAs were examined in an immunoprecipitation assay. ...
Web Search - Get it from MIT Libraries
ROLE OF THE TAL1/SCL TRANSCRIPTION FACTOR IN NORMAL AND LEUKEMIC HEMATOPOIESIS
SJ BRANDT - doi.wiley.com
... Importantly, Msh2\ \ mice developed thymic lymphomas that, similar to their human
counterparts, fre- quently coexpressed Tal1 and Lmo2 (Lowsky et al., 1997). ...
Web Search
The LMO2 T-cell oncogene is activated via chromosomal translocations or retroviral insertion during … - Full text - MIT Libraries
MP McCormack, A Forster, L Drynan, R Pannell, TH … - Mol Cell Biol, 2003 - pubmedcentral.nih.gov
... It has been shown that in Lmo2-Tal1/Scl double transgenic mice have increased
efficacy in T-cell leukemia development (17). In addition ...
Cited by 10 - Web Search - dx.doi.org - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
A PAR domain transcription factor is involved in the expression from a hematopoietic-specific … - Full text - MIT Libraries
SC Crable, KP Anderson - Blood, 2003 - bloodjournal.org
... factor LMO2 is believed to exert its effect through the formation of protein-protein
interactions with other DNA-binding factors such as GATA-1 and TAL1. ...
Web Search - ncbi.nlm.nih.gov
Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms - Full text - MIT Libraries
ME Massari, C Murre, R Articles - Mol. Cell. Biol, 2000 - dx.doi.org
... Targeted deletion of these genes in mice has demonstrated that both Tal1 and Lmo2
are required for erythroid development (127, 151, 166, 170). ...
Cited by 292 - Web Search - mcb.asm.org - www-biology.ucsd.edu - sig.biostr.washington.edu - all 9 versions »
The Tal1 Oncoprotein Inhibits E47-mediated Transcription - Full text - MIT Libraries
MOF INHIBITION - J Biol Chem, 1998 - jbc.org
... Coexpression of Tal1 and LMO1 or LMO2 in T cells appears to enhance the ability
of Tal1 to activate transcription of a reporter gene driven by multiple copies ...
Web Search - jbc.org
Helix-loop-helix(E 2-5, HEB, TAL 1 and Id 1) protein interaction with the TCRalphadelta enhancers - Full text - MIT Libraries
M Bernard, E Delabesse, L Smit, C Millien, IR … - International Immunology, 1998 - intimm.oupjournals.org
... 1998 Oxford University Press Helix-loop-helix (E2-5, HEB, TAL1 and Id1) ... TCR
[αE1-2] activity was partially (40%) inhibited by TAL1 but not at all by Id1. ...
Cited by 6 - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Vascular gene expression and phenotypic correlation during differentiation of human embryonic stem … - Full text - MIT Libraries
S Gerecht-Nir, JE Dazard, M Golan-Mashiach, S … - Developmental Dynamics, 2005 - doi.wiley.com
... 2003), CD45 (Mikkola et al., 2003; Ferkowicz et al., 2003), and transcrip- tion
factors TAL1, LMO2, GATA1, GATA2, and GATA3, although up-reg- ulation of the ...
Cited by 2 - Web Search - weizmann.ac.il - weizmann.ac.il - ncbi.nlm.nih.gov
Mechanisms regulating the origins of the vertebrate vascular system - Full text - MIT Libraries
MS Saha, EA Cox, CW Sipe - Journal of Cellular Biochemistry, 2004 - doi.wiley.com
... pathway may promote the initial commitment of the hemangioblast lineage, but in
its absence the role is assumed by other factors such as Scl- Tal1 or Lmo2. ...
Web Search - ncbi.nlm.nih.gov
THE LMO2 MASTER GENE; ITS ROLE AS A TRANSCRIPTION REGULATOR DETERMINING CELL FATE IN LEUKEMOGENESIS …
C TRANSLOCATIONS, D REGULATION - doi.wiley.com
... This turned out to be even more germane, since it was shown that the Lmo2 and Tal1
proteins could interact directly with each other (Valge- Archer et al., 1994 ...
Web Search
mSin3A regulates murine erythroleukemia cell differentiation through association with the TAL1 (or … - Full text - MIT Libraries
S Huang, SJ Brandt - Mol Cell Biol, 2000 - mcb.asm.org
... As the binding preferences of TAL1-E2A heterodimers (50) differ from those of complexes
containing TAL1, GATA-1, Ldb-1, and LMO1 or LMO2 (103), specific ...
Cited by 18 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
The Lim-only protein LMO4 modulates the transcriptional activity of HEN1 - Full text - MIT Libraries
C Manetopoulos, A Hansson, J Karlsson, JI Jonsson, … - Biochemical and Biophysical Research Communications, 2003 - ingentaconnect.com
... has been shown that TAL1 forms complex with LMO proteins in erythroid and leukemic
cells we investigated the capacity of HEN1 to form complex with LMO2 and LMO4 ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - lu-research.lub.lu.se - all 6 versions »
The GATA-E box-GATA motif in the EKLF promoter is required for in vivo expression - Full text - MIT Libraries
KP Anderson, SC Crable, JB Lingrel - Blood, 2000 - bloodjournal.org
... 23 , 30 Significantly, targeted ablations of the gene for either GATA1, Tal1, or
Lmo2 all result in a failure in development of the hematopoietic system. ...
Cited by 8 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Identification of the LMO 4 gene encoding an interaction partner of the LIM-binding protein LDB 1/ … - Full text - MIT Libraries
G Grutz, A Forster, TH Rabbitts - Oncogene, 1998 - nature.com
... A role in these cell types seems to be carried out by the formation of a multimeric
DNA-binding complex including Lmo2, Tal1, E47, GATA-1 and Ldb1 (Wadman et al ...
Cited by 20 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Biallelic transcriptional activation of oncogenic transcription factors in T-cell acute … - Full text - MIT Libraries
AA Ferrando, S Herblot, T Palomero, M Hansen, T … - Blood, 2004 - dx.doi.org
... Aberrant expression of transcription factor oncogenes such as HOX11, HOX11L2,
TAL1/SCL, LYL1, LMO1, and LMO2 can be detected in lymphoblasts from up to 80% of ...
Cited by 8 - Web Search - dx.doi.org - bloodjournal.org - ncbi.nlm.nih.gov - all 5 versions »
Activating FLT3 mutations in CD117/KIT T-cell acute lymphoblastic leukemias - Full text - MIT Libraries
E Paietta, AA Ferrando, D Neuberg, JM Bennett, J … - Blood, 2004 - bloodjournal.org
... 19,20. We have shown that the oncogenic transcription factor genes, HOX11, HOX11L2,
TAL1, LYL1, LMO2, and MLL-ENL identify discrete molecular groups of T-ALL. ...
Cited by 6 - Web Search - dx.doi.org - bloodjournal.org - ncbi.nlm.nih.gov - all 5 versions »
Lmo2 and GATA-3 associated expression in intraembryonic hemogenic sites - Full text - MIT Libraries
A Manaia, V Lemarchandel, M Klaine, I Max-Audit, P … - Development, 2000 - dev.biologists.org
... Besides common signaling pathways involving, for example, Tal-1/SCL, Lmo2,
GATA-1 and GATA- 2, a number of specific genes (including GATA-3, c-myb, AML- 1 ...
Cited by 37 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Chromosomal translocations and leukaemia: a role for LMO2 in T cell acute leukaemia, in …
TH Rabbitts, H Axelson, A Forster, G Grutz, I … - Leukemia, 1997 - ncbi.nlm.nih.gov
... LMO2 has been shown to cause tumours when aberrantly expressed and to be able
to heterodimerise with TAL1 to facilitate tumour development. ...
Cited by 4 - Web Search - Get it from MIT Libraries
Deregulated expression of the TAL1 gene by t (1; 5)(p32; q31) in patient with T-cell acute …
S Francois, E Delabesse, L Baranger, M Dautel, C … - GENES, CHROMOSOMES & CANCER, 1998 - doi.wiley.com
... Larson RC, Lavenir I, Larson TA, Baer R, Warren AJ, Wadman I, Nottage K, Rabbitts
TH (1996) Protein dimerization between lmo2 (Rbtn2) and tal1 alters thymocyte ...
Cited by 8 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
SCL and LMO 1 alter thymocyte differentiation: inhibition of E 2 A-HEB function and pre-T< img … - Full text - MIT Libraries
S Herblot, AM Steff, P Hugo, PD Aplan, T Hoang - Nature Immunology, 2000 - nature.com
... 13. Larson, RC et al. Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters
thymocyte development and potentiates T cell tumorigenesis in transgenic mice. ...
Web Search
The LMO 1 and LDB 1 proteins interact in human T cell acute leukaemia with the chromosomal … - Full text - MIT Libraries
V Valge-Archer, A Forster, TH Rabbitts - Oncogene, 1998 - nature.com
... for the existence of an LMO1- containing oligomeric complex, which would be the
analogue of those found with Lmo2, is restricted to data with LDB1 and TAL1. ...
Cited by 12 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
HOX11L2 expression defines a clinical subtype of pediatricT-ALLassociated with poor prognosis - Full text - MIT Libraries
LMO LYL - Blood, 2002 - bloodjournal.org
... T-ALL Patient HOX11L2 HOX11 LYL1 LMO2 TAL1 SIL- TAL1 CDKN2A/ CDKN2D Karyotype
UPNT1 10 520 — ND ND ND ND 46,XY[11] UPNT1 relapse ...
Cited by 21 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Gene expression profiling in T-cell acute lymphoblastic leukemia
AA Ferrando, AT Look - Semin Hematol, 2003 - ncbi.nlm.nih.gov
... Gene expression studies indicate activation of a subset of these genes-HOX11, TAL1,
LYL1, LMO1, and LMO2-in a much larger fraction of T-ALL cases than those ...
Cited by 9 - Web Search - Get it from MIT Libraries
Multiple Proteins Binding to a GATA-E Box-GATA Motif Regulate the Erythroid Kruppel-like Factor(EKLF … - Full text - MIT Libraries
KP Anderson, SC Crable, JB Lingrel - J Biol Chem, 1998 - jbc.org
... Other critical genes involved in hematopoiesis include GATA-1, Tal1, and Lmo2/rbtn2. ...
Lmo2 and Tal1 can be found as a complex in erythroid cells (20). ...
Cited by 21 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia - Full text - MIT Libraries
AA Ferrando, DS Neuberg, J Staunton, ML Loh, C … - Cancer Cell, 2002 - ingentaconnect.com
... Here we show that five different T cell oncogenes (HOX11, TAL1, LYL1, LMO1, and
LMO2) are often aberrantly expressed in the absence of chromosomal abnormalities ...
Cited by 115 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 4 versions »
Tie2Cre-mediated gene ablation defines the stem-cell leukemia gene (SCL/tal1)–dependent window … - Full text - MIT Libraries
TM Schlaeger, HK Mikkola, C Gekas, HB Helgadottir, … - Blood, 2005 - bloodjournal.org
... on the basic helix-loop-helix (bHLH) transcription factor/T-cell oncogene SCL/tal1. ...
10,11 When expressed with its partners LIM only protein 2 (LMO2) and GATA ...
Web Search - dx.doi.org - bloodjournal.org - ncbi.nlm.nih.gov
|
©2005 Google