![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 11 of 11 for TBP and EN1. (0.06 seconds) |
The mouse homolog of the orphan nuclear receptor tailless is expressed in the developing forebrain - Full text - MIT Libraries
AP Monaghan, E Grau, D Bock, G Schuetz - Development, 1995 - dev.biologists.org
... To identify a potential upstream gene of HNF-3β or En1 in mice, we have ... The TBP probe
used as a control has been previously described (Tamura et al., 1991). ...
Cited by 32 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
The human chorionic somatomammotropin enhancers form a composite silencer in pituitary cells in … - Full text - MIT Libraries
SW Jiang, NL Eberhardt - Mol. Endocrinol, 1997 - mend.endojournals.org
... specific TAFs or other coactivators, may change their mode of interaction with TBP. ...
and CSEn5 were ligated to BglII-digested 493CSp.LUC to generate En1 CSp.LUC ...
Cited by 4 - Web Search - dx.doi.org - mend.endojournals.org - ncbi.nlm.nih.gov
The core promoter of hepatitis B virus - Full text - MIT Libraries
A Kramvis, MC Kew - Journal of Viral Hepatitis, 1999 - blackwell-synergy.com
... There is a single HNF4 site in the EN1/X-gene promoter region and two additional ...
binding to the AT-rich regions of the CP [27,28] the ubiquitous TBP plays an ...
Cited by 20 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Functional equivalence of the transcription factors Pax2 and Pax5 in mouse development - Full text - MIT Libraries
M Bouchard, P Pfeffer, M Busslinger - Development, 2000 - dev.biologists.org
... constitutes an interaction surface for the retinoblastoma (Rb) and
TATA-binding (TBP) proteins (Eberhard and Busslinger, 1999). ...
Cited by 41 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
Variation of serotonergic gene expression: neurodevelopment and the complexity of response to …
KP Lesch - Eur Neuropsychopharmacol, 2001 - uni-wuerzburg.de
... The transcription initiation complex comprises multiple factors, including the TATA
box binding protein (TBP) with TBP-associated factors, coactivators, and ...
Cited by 13 - View as HTML - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The psychopharmacogenetic-neurodevelopmental interface in serotonergic gene pathways
KP Lesch, J Benninghoff, A Schmitt - Pharmacogenetics of psychotropic drugs, 2002 - uni-wuerzburg.de
... The transcription initiation complex comprises multiple factors, including the TATA
box-binding protein (TBP) with TBP-associated factors, coactivators, and ...
Cited by 1 - View as HTML - Web Search
[BOOK] De Grondwet: een systematisch en artikelsgewijs commentaar
AK Koekkoek - 2000 - print.google.com
... 3, 8 en 9. Prof. mr. BP Vermeulen, Artikelen 2, 6 en 7. Mr. PJJ Zoontjens, Artikelen
3 en1 1 . Dr. GJ Leenknegt, Artikel 4; Artikelen 24-41 ; Artikelen 50-64. ...
Cited by 1 - Web Search - Get it from MIT Libraries - Library Search
Integrability conditions for irrotational dust with a purely electric Weyl tensor: A tetrad analysis - Full text - MIT Libraries
WM Lesame, PKS Dunsby, GFR Ellis - Physical Review D, 1995 - link.aps.org
... and "E" equations, respectively, and 52 3407 WM LESAME, PKS DUNSBY, AND GFR ELLIS
7,tbp UbO.dpEqd ... (A3) takes the final form 0 = h('n7/j)klm Uk [(_7n);m - En1 jp ...
Cited by 16 - Web Search - arxiv.org - adsabs.harvard.edu - ncbi.nlm.nih.gov - all 6 versions »
Specific homeodomain-DNA interactions are required for HOX11-mediated transformation - Full text - MIT Libraries
BM Owens, YX Zhu, TC Suen, PX Wang, JF Greenblatt, … - Blood, 2003 - bloodjournal.org
... galactosidase. Mutants of pSV2CAT were generated by making deletions using
convenient restriction sites: pSV2 En1 was generated by ...
Cited by 2 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Hormone-dependent Recruitment of NF-Y to the Uteroglobin Gene Enhancer Associated with Chromatin … - Full text - MIT Libraries
A Scholz, M Truss, M Beato - J Biol Chem, 1999 - jbc.org
... For the upper strand: En1, CTTTGCTTGATTGGCC; En2, CTTGATGTTCACTAAACAGGCACCTTGG;
En3, GCACCTTGGAACGAATCAGTGAACAGGCC ... NF-Y B and NF-Y C interact with TBP (83), and ...
Cited by 3 - Web Search - jbc.org - ncbi.nlm.nih.gov
[BOOK] AIDS in Africa
M Essex, S Mboup, PJ Kanki, RG Marlink, SD Tlou - 2002 - print.google.com
Page 1. AIDS in Africa Second Edition Page 2. AIDS in Africa Second Edition
Edited by Max Essex, DVM, PhD Chaüm on, lkn,ard AIDS ...
Cited by 2 - Web Search - Get it from MIT Libraries - Library Search
|
©2005 Google