![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 180 for TBP and SRY. (0.22 seconds) |
Modeling DNA deformations induced by minor groove binding proteins - Full text - MIT Libraries
A Lebrun, R Lavery - Biopolymers, 1999 - doi.wiley.com
... Molecular modeling is used to demonstrate that the major structural deformations
of DNA caused by four different minor groove binding proteins, TBP, SRY, LEF-1 ...
Cited by 7 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
MINOR GROOVE-BINDING ARCHITECTURAL PROTEINS: Structure, Function, and DNA Recognition 1 - Full text - MIT Libraries
CA Bewley, AM Gronenborn, GM Clore - Annual Review of Biophysics and Biomolecular Structure, 1998 - ncbi.nlm.nih.gov
... Although structurally distinct from TBP, SRY and LEF-1 also serve to bend DNA and
do so in a manner analogous to TBP, namely by in- sertion of a hydrophobic ...
Cited by 60 - View as HTML - Web Search - spin.niddk.nih.gov - astro.annualreviews.org - ncbi.nlm.nih.gov
Modulation of DNA Conformations Through the Formation of Alternative High-order HU-DNA Complexes - Full text - MIT Libraries
D Sagi, N Friedman, C Vorgias, AB Oppenheim, J … - Journal of Molecular Biology, 2004 - ncbi.nlm.nih.gov
... It belongs to a small class of proteins that includes the eukaryotic proteins TBP,
SRY, HMG-I and LEF-I, which bind to DNA non-specifically at the minor groove ...
Cited by 2 - Web Search - csa.com
… spectroscopic analysis of the DNA conformation induced by the human testis determining factor SRY - Full text - MIT Libraries
MH Werner, ME Bianchi, AM Gronenborn, GM Clore - Biochemistry, 1995 - ncbi.nlm.nih.gov
... The structural features of the DNA complexed to SRY are remarkably similar, but
not identical, to those of DNA complexed to the TATA-binding protein (TBP). ...
Cited by 30 - Web Search - ncbi.nlm.nih.gov
1. 9 Aa resolution refined structure of TBP recognizing the minor groove of TATAAAAG - Full text - MIT Libraries
JL Kim, SK Burley - Nature Structural Biology, 1994 - nature.com
... Kim, Y., Geiger, JH, Hahn, S. & Sigler, PB Crystal structure of a yeast
TBP/TATA-box ... | PubMed | ISI | ChemPort |; King, CY & Weiss, MA The SRY high-mobility ...
Cited by 70 - Web Search
Annual Review of Biophysics and Biomolecular Structure - Full text - MIT Libraries
MGBA PROTEINS - Annual Review of Biophysics and Biomolecular Structure, 1998 - biophys.annualreviews.org
... Figure 1 Three-dimensional structures of the minor-groove binding architectural
proteins TBP, SRY, IHF, and HMG I in complex with their DNA targets. ...
Web Search - biophys.annualreviews.org
SRY and architectural gene regulation: the kinetic stability of a bent protein-DNA complex can … - Full text - MIT Libraries
E Ukiyama, A Jancso-Radek, B Li, L Milos, W Zhang, … - Molecular Endocrinology, 2001 - mend.endojournals.org
... Binding of the SRY HMG box causes marked changes in phase- and modulation curves
(Fig. 5 A). Similar changes occur on binding of TBP to its DNA site (51). ...
Cited by 13 - Web Search - mgh.harvard.edu - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
The biochemical role of SRY in sex determination
V R Harley, P N Goodfellow - Molecular Reproduction and Development, 1994 - doi.wiley.com
... 1994) The Biochemical Role of SRY in Sex Determination VR HARLEY ... The in vivo
DNA target for SRY, however, remains elusive. Here, we show ...
Cited by 26 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The porcine gene TBP 10 encodes a protein homologous to the human Tat-binding protein/26 S protease …
T Leeb, G Rettenberger, J Bruch, H Hameister, B … - Mammalian Genome, 1996 - springerlink.com
... To further elucidate the structural and functional relatedness between the TBP-like
proteins and the ... SSC 8), GH (SSC 12), TF (SSC 13), DAO (SSC 14), SRY (SSC Y ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Interaction of human SRY protein with DNA: A molecular dynamics study - Full text - MIT Libraries
Y Tang, L Nilsson - Proteins Structure Function and Genetics, 1998 - doi.wiley.com
Page 1. Interaction of Human SRY Protein With DNA: ... 6 Mutations in the SRY gene usually
result in gonadal dysgenesis of the XY female type (Swyer syndrome). ...
Cited by 12 - Web Search - cbt.ki.se - csb.ki.se - ncbi.nlm.nih.gov - all 6 versions »
Protein-induced DNA bending: the role of phosphate neutralisation - Full text - MIT Libraries
R Gurlie, K Zakrzewska - Theor Chem Acc, 2001 - springerlink.com
... This mechanism was proposed for proteins which bind in the DNA minor groove, such
as TBP, SRY and LEF-1 [5, 6, 7]. By partially intercalating amino acid side ...
Web Search
Flexing DNA: HMG-Box Proteins and Their Partners - Full text - MIT Libraries
ME Bianchi, M Beltrame - The American Journal of Human Genetics, 1998 - journals.uchicago.edu
... N, Boizet B, et al (1997) The human testis determining factor SRY binds a ... ME, Bernués
J. HMG1 interacts with the core domain of human TBP and interferes with ...
Cited by 37 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
EUKARYOTIC TRANSCRIPTION FACTOR-DNA COMPLEXES - Full text - MIT Libraries
G Patikoglou, SK Burley - Annual Review of Biophysics and Biomolecular Structure, 1997 - biophys.annualreviews.org
... Like TBP, both SRY and LEF-1 make additional side chain-minor groove base edge
interactions that are primarily hydrophobic, further distorting the trajectory ...
Cited by 50 - Web Search - biophys.annualreviews.org - plant.annualreviews.org - ncbi.nlm.nih.gov
The hyperthermophile chromosomal protein Sac 7 d sharply kinks DNA - Full text - MIT Libraries
H Robinson, YG Gao, BS McCrary, SP Edmonson, JW … - Nature, 1998 - nature.com
... JL, Nikolov, DB & Burley, SK Co-crystal structure of TBP recognizing the ... revealed
from the three-dimensional solution structure of the human SRY-DNA complex. ...
Cited by 63 - Web Search - nature.com - ncbi.nlm.nih.gov - csa.com
Modelling DNA stretching for physics and biology
R Lavery, A Lebrun - Genetica, 1999 - springerlink.com
... RMS values (Å) refer to the stretched base pair segment within the DNA binding
site (TBP: TATA, SRY: CACAAA, LEF-1: CTTT, PurR: ACGT). ...
Cited by 7 - Web Search - kluweronline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Binding of proteins to the minor groove of DNA: What are the structural and energetic determinants … - Full text - MIT Libraries
D Bosch, M Campillo, L Pardo - Journal of Computational Chemistry, 2003 - doi.wiley.com
... In the case of the TBP– DNA interaction, the mechanism of DNA bending has ... 24 The
SRY-DNA complex was not included in the simulations because the furanose ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov
Partial intercalation with nucleic acids of peptides containing aromatic and basic amino acids
C Robledo-Luiggi, M Vera, L Cobo, E Jaime, C … - Biospectroscopy, 1999 - doi.wiley.com
... teins. 1 SRY, PurR, TBP, and ETS1 are reported to use side-chain intercalation
to pry open a single base step and distort the DNA. 2 ...
Cited by 2 - Web Search - doi.wiley.com - Get it from MIT Libraries
Effect of the non-conserved N-terminus on the DNA binding activity of the yeast TATA binding protein - Full text - MIT Libraries
R Kuddus, MC Schmidt - Nucleic Acids Res, 1993 - pubmedcentral.nih.gov
... involving the N-terminus of TBP may be one of the isomerization steps in the formation
of a stable TBP-DNA complex ... SRY, like HMG1, recognizes sharp angles in DNA ...
Cited by 15 - Web Search - nar.oupjournals.org - ncbi.nlm.nih.gov
Probing the DNA kink structure induced by the hyperthermophilic chromosomal protein Sac 7 d - Full text - MIT Libraries
CY Chen, TP Ko, TW Lin, CC Chou, CJ Chen, HJW … - Nucleic Acids Research, 2005 - nar.oupjournals.org
... role of several classes of the minor groove DNA-binding proteins, including TBP
(15–17), PurR (18), LacI (19), IHF (20), HU (21), HMG1 (22), SRY (23), LEF-1 ...
Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Eukaryotic Transcription continued
I II III - cluster3.biosci.utexas.edu
... Page 9. 18.9 February 19, 2000 Examples are HMG (high mobility group proteins):
SRY Lef1 Tata binders: TBP oncogene: human ets1 E. coli Purine Repressor: PurR ...
View as HTML - Web Search - zo.utexas.edu - lifesci.utexas.edu - micro.utexas.edu
Molecular mechanisms involved in cisplatin cytotoxicity - Full text - MIT Libraries
P Jordan, M Carmo-Fonseca - Cell Mol Life Sci, 2000 - springerlink.com
... cells alleviates the reduction in RNA synthesis, suggesting that TBP is sequestered ...
domain proteins included the transcrip- tion factors UBF [38], SRY [39], LEF ...
Cited by 49 - Web Search - ncbi.nlm.nih.gov
TATA binding protein discriminates between different lesions on DNA, resulting in a transcription … - Full text - MIT Libraries
F Coin, P Frit, B Viollet, B Salles, JM Egly - Mol. Cell. Biol, 1998 - mcb.asm.org
... Cisplatin- and UV-damaged DNA lure the basal transcription factor TFIID/TBP. ... revealed
from the three-dimensional solution structure of the human SRY-DNA complex ...
Cited by 13 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
A survey of introns in three genes of rotifers
DBM Welch, M Meselson - Hydrobiologia, 2001 - springerlink.com
... binding protein 1 (TBP-1): conserved exon/intron structure in eukaryotic TBP genes ...
De novo insertion of an intron into the mammalian sex determining gene, SRY. ...
Cited by 3 - Web Search - kluweronline.com
Transcription Factors
S Veeraraghavan - www-bmb.med.uth.tmc.edu
... Structures are known for: TATA-binding protein [TBP] Integration host factor [IHF]
High mobility group I(Y) [HMG I(Y)] HMG-box proteins SRY and LEF-1 ...
View as HTML - Web Search
The RNA polymerase I transactivator upstream binding factor requires its dimerization domain and … - Full text - MIT Libraries
CD Putnam, GP Copenhaver, ML Denton, CS Pikaard - Mol. Cell. Biol, 1994 - pubmedcentral.nih.gov
... SRY, like HMG1, recognizes sharp angles in DNA. EMBO J 1992 Dec;11(12):4497–4506. ...
Co-crystal structure of TBP recognizing the minor groove of a TATA element. ...
Cited by 29 - Web Search - mcb.asm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Orphon spliced-leader sequences form part of a repetitive element in Angiostrongylus cantonensis. - Full text - MIT Libraries
GW Joshua, FB Perler, CC Wang - Nucleic Acids Res, 1995 - pubmedcentral.nih.gov
... PN, Scherer G. A familial mutation in the testis-determining gene SRY shared by ...
Co-crystal structure of TBP recognizing the minor groove of a TATA element. ...
Cited by 1 - Web Search - nar.oupjournals.org - ncbi.nlm.nih.gov
Using nuclear targeting signals to enhance non-viral gene transfer - Full text - MIT Libraries
CK Chan, DA Jans - Immunology and Cell Biology, 2002 - blackwell-synergy.com
... of IMP- and DNA binding may be physiologically relevant to GAL4 nuclear import under
normal circumstances; similar mechanisms may apply to SRY, TBP and Npl3p. ...
Cited by 9 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
High Mobility Group Protein 1 Interacts Specifically with the Core Domain of Human TATA Box-binding … - Full text - MIT Libraries
M Sutrias-Grau, ME Bianchi, J Bernues - J Biol Chem, 1999 - jbc.org
... for the HMG box domains of several other proteins such as UBF and SRY (7, 8 ... and HOXD9
(9, 10), and full-length HMG1 has been shown to interact with TBP (11) and ...
Cited by 14 - Web Search - jbc.org - ncbi.nlm.nih.gov
Local DNA stretching mimics the distortion caused by the TATA box-binding protein - Full text - MIT Libraries
A Lebrun, Z Shakked, R Lavery - Proc. Natl. Acad. Sci. USA, 1997 - pnas.org
... protein. TBP thus represents a new model for DNA binding, which is shared
by several other proteins, notably SRY and LEF (8, 9). ...
Cited by 34 - Web Search - pubmedcentral.nih.gov - lps.ens.fr - dx.doi.org - all 6 versions »
Floppy SOX: mutual induced fit in HMG (high-mobility group) box-DNA recognition - Full text - MIT Libraries
MA Weiss - Mol. Endocrinol, 2001 - mend.endojournals.org
... base stacking as observed in SRY (39, 40). Such partial intercalation is similar
to that observed in DNA complexes of the TATA-binding protein (TBP) (41, 42 ...
Cited by 14 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Structure of recombinant rat UBF by electron image analysis and homology modelling - Full text - MIT Libraries
KJ Neil, RA Ridsdale, B Rutherford, L Taylor, DE … - J. Biol. Chem, 1997 - nar.oupjournals.org
... the TATA box binding protein (TBP), along with other TBP-associated factors ... HMG-boxes
from lymphoid enhancer factor 1, SRY (a transcription factor encoded by ...
Cited by 6 - Web Search - nar.oxfordjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Structure, Function, and Biology - Full text - MIT Libraries
RS Hegde - Annu. Rev. Biophys. Biomol. Struct, 2002 - phyto.annualreviews.org
... Predominantly hydropho- bic protein-DNA interfaces, as observed in complexes of
DNA with TBP and the SRY and LEF proteins, are thought to increase the ...
Web Search
Binding to four-way junction DNA: a common property of architectural proteins - Full text - MIT Libraries
J Zlatanova, K van Holde - FASEB J, 1998 - fasebj.org
... mtTF, HM), to those that possess a well-defined consensus sequence (eg, SRY,
LEF-1 ... The TATA binding protein TBP also interacts with the minor groove of the TATA ...
Cited by 47 - Web Search - fasebj.org - ncbi.nlm.nih.gov
Annual Review of Biophysics and Biomolecular Structure - Full text - MIT Libraries
RS Hegde - Annual Review of Biophysics and Biomolecular Structure, 2002 - biophys.annualreviews.org
... Predominantly hydrophobic protein-DNA interfaces, as observed in complexes of DNA
with TBP and the SRY and LEF proteins, are thought to increase the repulsion ...
Web Search - biophys.annualreviews.org - plant.annualreviews.org - plant.annualreviews.org
Analysis of the human TATA binding protein promoter and identification of an ets site critical for … - Full text - MIT Libraries
C Foulds, DK Hawley - Nucleic Acids Research, 1997 - nar.oupjournals.org
... 45). Analysis of the published mouse TBP 5[prime]-flanking sequence ( 21)
also revealed possible SRY sites in that promoter region. ...
Cited by 8 - Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
The murine gene encoding parathyroid hormone: genomic organization, nucleotide sequence and …
B He, TK Tong, FF Hiou-Tim, B Al-Akad, HM … - J Mol Endocrinol, 2002 - journals.endocrinology.org
... GR, glucocorticoid receptor; CRE-BP, cAMP response element binding protein;
Sox-5, SRY-related high mobility group box protein 5; TFIID (TBP), TATA binding ...
Cited by 4 - View as HTML - Web Search - journals.endocrinology.org - jme.endocrinology-journals.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Identification and characterization of the human XIST gene promoter: implications for models of X … - Full text - MIT Libraries
B Hendrich, RM Plenge, HF Willard - Nucleic Acids Research, 1997 - nar.oupjournals.org
... sc-204; monoclonal anti-TBP, no. ... see above); transgene G6H6, primers G6
(TACTCTTCCACTCACTTTTC) and H6 (AGAGAGTGCAACAACCCACA)] and primers for the Sry gene ...
Cited by 23 - Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Protein-directed DNA structure. I. Raman spectroscopy of a high-mobility-group box with application … - Full text - MIT Libraries
JM Benevides, G Chan, XJ Lu, WK Olson, MA Weiss, … - Biochemistry, 2000 - chmwww.rutgers.edu
... proposed as a baseline for comparative analysis of mutations in SRY that cause ... resonance;
RMD, root-mean-distance; SDS, sodium dodecyl sulfate; TBP, TATA-box ...
Cited by 7 - View as HTML - Web Search - rutchem.rutgers.edu - pound.med.utoronto.ca - ncbi.nlm.nih.gov - all 5 versions »
Self-compression and Raman soliton generation in a photonic crystal fiber of 100-fs pulses produced … - Full text - MIT Libraries
F Druon, N Sanner, G Lucas-Leclin, P Georges, KP … - Applied Optics, 2003 - ao.osa.org
... soliton whose spectrum is highly al- tered by the SPM, the TBP increases to ... S.
Dhellemmes, V. Ortiz, and C. Larat, “Apatite-structure crystal, Yb 3 SrY 4 SiO ...
Cited by 4 - Web Search - aoot.osa.org - adsabs.harvard.edu - ncbi.nlm.nih.gov - all 5 versions »
Eukaryotic gene regulation: a flew over the transcription factor nest
P Ziros, AG Papavassiliou - mednet.gr
... of the BTFs now detach from the core promoter, leaving TFIID (or possibly just TBP)
bound to ... the high mobility group (HMG) box; found in SRY, the mammalian ...
View as HTML - Web Search
Probing the DNA kink structure induced by the hyperthermophilic chromosomal protein Sac7d using site …
CY Chen, TP Ko, TW Lin, CC Chou, HJW Andrew - gra103.aca.ntu.edu.tw
... Structural studies of these include TBP (14-15), Lac1/PurR (16-17), SRY
(18)/LEF-1 (19), IHF (20), and HMG1 (21) that complexes with their cognate specific ...
View as HTML - Web Search
Effects of phosphate neutralization on the shape of the AP-1 transcription factor binding site in … - Full text - MIT Libraries
L Tomky, JK Strauss-Soukup, LJ Maher III - Nucleic Acids Research, 1998 - nar.oupjournals.org
... Molecules in this class include TBP (7,8), HMG box proteins such as SRY and
LEF-1 (9,10), and others that are often classified as `architectural' binding ...
Cited by 10 - Web Search - biosci.ohio-state.edu - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
PCR-based development of DNA substrates containing modified bases: an efficient system for … - Full text - MIT Libraries
C Bailly, D Payet, AA Travers, MJ Waring - Proc. Natl Acad. Sci. USA, 1996 - pnas.org
... that the minor groove of the helix is not the preserve of small molecules but can
serve as a receptor for several proteins (eg, SRY, LEF-1, PurR, TBP, HMG-1 ...
Cited by 16 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Human Muellerian inhibiting substance promoter contains a functional TFII-I-binding initiator - Full text - MIT Libraries
N Morikawa, TR Clarke, CD Novina, K Watanabe, C … - Biol Reprod, 2000 - bioone.org
... play an important role in the basal transcription of TdT by recruiting TBP to the ...
We are grateful to David Page for the human SRY cDNA, to David Russell for ...
Cited by 8 - Web Search - biolreprod.org - mgh.harvard.edu - ncbi.nlm.nih.gov - all 6 versions »
Contribution of DNA Conformation and Topology in Right-handed DNA Wrapping by the Bacillus subtilis … - Full text - MIT Libraries
C Beloin, J Jeusset, B Revet, G Mirambeau, F Le … - Journal of Biological Chemistry, 2003 - jbc.org
... Numerous eukaryotic proteins (eg transcription factors, such as TBP or TFIIIA, or
structural high mobility group proteins, such as EF-1, SRY (8), HMG1 and HMG2 ...
Cited by 8 - Web Search - jbc.org - ncbi.nlm.nih.gov - csa.com
Molecular and Cytogenetic Characterization of Two Azoospermic Patients with X-Autosome Translocation
S Lee, SH Lee, TG Chung, HJ Kim, TK Yoon, IP Kwak, … - Journal of Assisted Reproduction and Genetics, 2003 - springerlink.com
... 152 (125bp), sY 147 (100bp), lane 2; sY 254 (401bp), SRY (203bp), sY ... growth factor
receptor Xq22.1 (TNFRSF16) associated protein 1 TAF2Q TBP-associated factor ...
Web Search - kluweronline.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
RNA processing and the control of spermatogenesis
WH Walker, FJ Delfino, JF Habener - Front. Horm. Res, 1999 - content.karger.com
... are expressed in the testis including Sox 17, Sox 5, Sox 6, and Sry. ... TATA-Binding
Protein TATA-binding protein (TBP) mRNA is markedly upregulated in sperma ...
Cited by 6 - Web Search - content.karger.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Microarray analysis of gene expression in human donor sclera - Full text - MIT Libraries
TL Young, GS Scavello, PC Paluru, JD Choi, EF … - Mol Vis, 2004 - molvis.org
... DEK 6p23 NM_021145 cyclin D binding myb-like DMTF1 7q21 transcription factor 1
NM_001938 down-regulator of transcription DR1 1p22.1 1, TBP-binding (negative ...
Cited by 3 - View as HTML - Web Search - molvis.org - scavello.net - ncbi.nlm.nih.gov
Structure-based prediction of DNA target sites by regulatory proteins - Full text - MIT Libraries
H Kono, A Sarai - Proteins Structure Function and Genetics, 1999 - doi.wiley.com
... 1BHMa Endonuclease BamHI 2.2 1CDW Human TBP core domain 1.9 1CMA Met repressor-operator
2.8 ... 1HMI HIV-1 reverse transcriptase 3.0 1HRY Human SRY NMR ...
Cited by 50 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genomic structure and chromosome location of the mouse RelA p65 gene (Rela)
ER Lemmer, JL Welch, T Tsai, CL Keck-Waggoner, CG … - Cytogenetics and Cell Genetics, 2000 - content.karger.com
... from the transcription start site is shown, together with putative binding sites
for transcription factors Sp1, TFIID, TBP, MAZ, TF68, GCM, Ftz, and Sry-Delta. ...
Cited by 1 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
| |
©2005 Google