![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 60 for TBP and USF1. (0.09 seconds) |
Did you mean: TBP and US F1
BMC Biochemistry - Full text - MIT Libraries
JF Barrett, LA Lee, CV Dang - BMC Biochemistry, 2005 - biomedcentral.com
... TBP is not limiting for USF1 TAD To determine whether the effect of TBP is selective,
we compared the ability of the USF1 TAD with the Myc TAD to synergize ...
View as HTML - Web Search
Stimulation of Myc transactivation by the TATA binding protein in promoter-reporter assays - Full text - MIT Libraries
JF Barrett, LA Lee, CV Dang - BMC Biochemistry, 2005 - biomedcentral.com
... 38]. By contrast, a GAL4-USF1 transactivator did not respond to increasing
input TBP. We ... TBP is not limiting for USF1 TAD. To determine ...
Cached - Web Search - dx.doi.org - pubmedcentral.nih.gov - citebase.eprints.org - all 7 versions »
CLONING, EXPRESSION, PURIFICATION AND CRYSTALLISATION OF THE HUMAN Ets-1/USF1/DNA COMPLEX & CRYSTAL …
FJ FERNENDEZ-PEREZ, P DOCTOR - tdx.cesca.es
... CLONING, EXPRESSION, PURIFICATION AND CRYSTALLISATION OF THE HUMAN Ets-1/USF1/DNA
COMPLEX & CRYSTAL STRUCTURE OF THERMOTOGA MARITIMA HISTIDINOL-PHOSPHATE ... USF1. ...
Web Search
Activation of transcription by recombinant upstream stimulatory factor 1 is mediated by a novel … - Full text - MIT Libraries
JP Halle, G Stelzer, A Goppelt, M Meisterernst - J Biol Chem, 1995 - jbc.org
... 3, 16, 17, 18, 19) with one of the TBP-associated factors ... Although recombinant USF1
is able to activate transcription in nuclear extracts indistinguishable ...
Cited by 17 - Web Search - jbc.org - ncbi.nlm.nih.gov
The dual role of helix– loop– helix-zipper protein USF in ribosomal RNA gene transcription in … - Full text - MIT Libraries
AK Ghosh, PK Datta, ST Jacob - Oncogene, 1997 - nature.com
... of rDNA transcription by as much as 85 ± 90% whereas overexpression of USF1/USF2
in ... A complex called SL1 that consists of TATA box-binding protein TBP and pol ...
Cited by 17 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
A 69-Base Pair Fragment Derived from Human Transcobalamin II Promoter Is Sufficient for High … - Full text - MIT Libraries
N Li, B Seetharam - Journal of Biological Chemistry, 1998 - jbc.org
... 23), whereas the E box was recognized by both USF1 and USF2 (Fig ... a TATA box or an
Inr element that are recognized by the TATA-binding protein (TBP), a component ...
Cited by 17 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
Transcription factor USF, expressed during the entire phase of varicella-zoster virus infection, … - Full text - MIT Libraries
M Rahaus, N Desloges, M Yang, WT Ruyechan, MH … - J Gen Virol, 2003 - jgv.sgmjournals.org
... RT-PCR and immunoblot assays indicate stable expression of both USF1 and USF2 ... VZV
IE4 (Spengler et al., 2000 ), IE63 (Lynch et al., 2002 ), TBP (TATA-box ...
Cited by 2 - Web Search - vir.sgmjournals.org - jgv.sgmjournals.org - ncbi.nlm.nih.gov - all 5 versions »
TAFII 250-independent Transcription Can Be Conferred on a TAFII 250-dependent Basal Promoter by … - Full text - MIT Libraries
JD Weissman, TK Howcroft, DS Singer - J Biol Chem, 2000 - jbc.org
... selectivity and are required to initiate at promoters that lack a TBP binding site ...
In contrast, USF1 and USF2, which also activate the class I promoter, do not ...
Cited by 10 - Web Search - jbc.org - ncbi.nlm.nih.gov
250-independent Transcription Can Be Conferred on a TAF
JD Weissman, TK Howcroft, DS Singer - jbc.org
... 1 The abbreviations used are: TAF, TBP-associated factor; MHC, major histocompatibility ...
In contrast, USF1 and USF2, which also activate the class I promoter ...
Web Search - genetics.biol.ttu.edu
Cloning of an Inr- and E-box-binding protein, TFII-I, that interacts physically and functionally … - Full text - MIT Libraries
AL Roy, H Du, PD Gregor, CD Novina, E Martinez, RG … - The EMBO Journal, 1997 - embojournal.npgjournals.com
... TFII-I showed the same DNA-binding specificity and interactions with USF1 as did ...
of native TFII-I was observed in a system reconstituted with TBP and other ...
Cited by 65 - Web Search - emboj.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Transcriptional Regulation of the Transforming Growth Factor-beta 2 Promoter by cAMP-responsive … - Full text - MIT Libraries
ML Kingsley-Kallesen, D Kelly, A Rizzino - J Biol Chem, 1999 - jbc.org
... Additionally, USF1 proteins do not appear to interact with nucleosomes that are ... to
the basal transcriptional machinery by binding TFIIB (42), TBP (59, 60), and ...
Cited by 15 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The RNA polymerase I promoter-activating factor CPBF is functionally and immunologically related to … - Full text - MIT Libraries
PK Datta, AK Ghosh, ST Jacob - J Biol Chem, 1995 - jbc.org
... I, initiation of rDNA transcription requires TATA-binding factor (TBP) and
TBP-associated pol ... the immune complex formed between the 43-kDa human USF1 and anti ...
Cited by 11 - Web Search - jbc.org - ncbi.nlm.nih.gov
Cellular factors and IE 62 activation of VZV promoters
WT Ruyechan, H Peng, M Yang, J Hay - Journal of Medical Virology, 2003 - doi.wiley.com
... Sp1 interacts with the TATA-binding protein (TPB) and the TBP associated factor
TAF 110 ... USF is encoded by two closely related genes in mammalian cells, USF1 and ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Characterization of the human ß-globin downstream promoter region - Full text - MIT Libraries
KM Leach, KF Vieira, SHL Kang, A Aslanian, M … - Nucleic Acids Research, 2003 - nar.oupjournals.org
... 5D, lanes 8–10), whereas antibodies against USF1 inhibited transcription only weakly
(Fig. ... For example, a recent report demonstrated that the TBP/TFII-A pre ...
Cited by 13 - Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Thioredoxin-Interacting Protein Is Stimulated by Glucose through a Carbohydrate Response Element and … - Full text - MIT Libraries
AH Minn, C Hafele, A Shalev - Endocrinology - endo.endojournals.org
... protein p40phox was identified as TBP-1 and TXNIP/VDUP1 as TBP-2. In ... promoter consists
of two E-boxes, potential ChoRE-binding proteins include USF1/2. These ...
Web Search - endo.endojournals.org
The RNA polymerase II core promoter: a key component in the regulation of gene expression - Full text - MIT Libraries
JEF Butler, JT Kadonaga - Genes & Development, 2002 - dx.doi.org
... TFIID is a multisubunit protein that consists of TBP (the TATA box-binding protein)
and approximately 13 TBP-associated factors (TAFs; Burley and Roeder 1996 ...
Cited by 47 - Web Search - genesdev.org - cm.utexas.edu - wisc.edu - all 16 versions »
Thioredoxin-interacting protein is stimulated by glucose through a carbohydrate response element and … - Full text - MIT Libraries
AH Minn, C Hafele, A Shalev - Endocrinology, 2005 - endo.endojournals.org
... identified as TBP-1 and TXNIP/VDUP1 as TBP-2. In addition, TXNIP exerts anti ... boxes,
potential ChorBPs include the upstream stimulatory factors (USF1/2) as these ...
Web Search - endo.endojournals.org - ncbi.nlm.nih.gov
Redistribution of transcription start sites within the FMR 1 promoter region with expansion of the … - Full text - MIT Libraries
A Beilina, F Tassone, PH Schwartz, P Sahota, PJ … - Human Molecular Genetics, 2004 - hmg.oupjournals.org
... thought to facilitate pol II complex formation either via interaction with TBP
(TFIID) and ... elements within the promoter region of the FMR1 gene, USF1/USF2 and ...
Cited by 6 - Web Search - wizard1.ucdavis.edu - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
Functional interaction between TATA and upstream CACGTG elements regulates the temporally specific … - Full text - MIT Libraries
A Kobayashi, K Akasaka, M Kawaichi, T Kokubo - Nucleic Acids Research, 2002 - nar.oupjournals.org
... is more similar to SpUSF than to LvUSF1, as was observed for TBP (Fig. ... using probes
from HpOtxE and HpOtxL promoter regions and USF1 consensus oligonucleotides ...
Cited by 3 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
A Transcriptional Initiator Overlaps with a Conserved YY1 Binding Site in the Long Control Region of … - Full text - MIT Libraries
SH Tan, CC Baker, W Stunkel, HU Bernard - Virology, 2003 - milkpa.idv.tw
... on the cooperation of two other initiator binding factors, TFII-I and USF1 (Du et
al ... to depend on TFIID, but is apparently not achieved by the TBP subunit, but ...
Cited by 2 - View as HTML - Web Search - ncbi.nlm.nih.gov
Role of the leucine zipper in the kinetics of DNA binding by transcription factor USF - Full text - MIT Libraries
T Lu, M Sawadogo - J Biol Chem, 1994 - jbc.org
... helix-loop-helix; LZ, leucine zipper; BT, basic tail; TBP, ‘The abbreviations ... by
apparent molecular weights in denaturating gel of 43,000 (USF1) and 44,000 ...
Cited by 2 - Web Search - jbc.org - ncbi.nlm.nih.gov
Molecular Machinery of the Transcription Initiation by RNA Polymerase II
Y Shidlovskii, PV Mardanov, ON Fedorova, EN … - RUSSIAN JOURNAL OF GENETICS, 2005 - springerlink.com
... For exam- ple, TAFs (TAF is the TBP-associated factor) are con- sidered to be both
GTFs and coregulators. ... TBP TBP is a key factor of transcription initiation. ...
Web Search - ingentaconnect.com
Human Muellerian inhibiting substance promoter contains a functional TFII-I-binding initiator - Full text - MIT Libraries
N Morikawa, TR Clarke, CD Novina, K Watanabe, C … - Biol Reprod, 2000 - bioone.org
... TFII-I, that interacts physically and functionally with USF1: EMBO J ... TBP-associated
factors are not generally required for transcriptional activation in yeast ...
Cited by 8 - Web Search - biolreprod.org - mgh.harvard.edu - ncbi.nlm.nih.gov - all 6 versions »
Identification of Target Genes of Oncogenic Transcription Factors - Full text - MIT Libraries
KE Boyd, PJ Farnham - Proceedings of The Society for Experimental Biology and …, 1999 - ebmonline.org
... USF1 and USF2 may encode redundant functions, mice lacking both USF1 and USF2 ... of
the basal RNA polymerase II transcriptional machinery, such as TBP, TFIIH, and ...
Cited by 14 - Web Search - ebmonline.org - ncbi.nlm.nih.gov
Mechanism for the transcriptional repression by c-Myc on PDGF beta-receptor - Full text - MIT Libraries
H Izumi, C Molander, LZ Penn, A Ishisaki, K Kohno, … - J. Cell Sci, 2001 - jcs.biologists.org
... The human TBP cDNA was provided by Dr Reinberg (Horward Hughes Medical Institute,
Piscataway, USA). For the expression of c-Myc, Max ...
Cited by 29 - Web Search - jcs.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Novel cofactors and TFIIA mediate functional core promoter selectivity by the human TAF II 150- … - Full text - MIT Libraries
E Martinez, H Ge, Y Tao, CX Yuan, V Palhan, RG … - Mol. Cell. Biol, 1998 - mcb.asm.org
... 33, 38, and 43), TIC-1 does not function in conjunction with TBP but, instead ... Specific
antisera against TFII-I, YY1, and USF1 were used to probe a Western blot ...
Cited by 34 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Upstream Stimulatory Factors Binding to an E Box Motif in the R Region of the Bovine Leukemia Virus … - Full text - MIT Libraries
C Calomme, TLA Nguyen, Y de Launoit, V Kiermer, L … - J Biol Chem, 2002 - jbc.org
... E box motif (5'-CACGTG-3'). By competition and supershift gel shift assays, we
demonstrated that the basic helix-loop-helix transcription factors USF1 and USF2 ...
Cited by 4 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Purification of General RNA Polymerase II Transcription Factors from Mouse for Studies of …
I Kotova - diva-portal.org
... NF-Y, and represses transcription through formation of an inhibitory complex with
TBP. ... effect on transcription in the presence of NF-Y or USF1, indicating that ...
Web Search - publications.uu.se
Identification of Target Genes of Oncogenic Transcription Factors (44425)
KE Boyd, PJ Farnham - ingentaconnect.com
... and USF2 may encode redundant func- tions, mice lacking both USF1 and USF2 ... of the
basal RNA polymerase II transcriptional machinery, such as TBP, TFIIH, and CBP ...
Web Search - genomics.ucdavis.edu - mcardle.oncology.wisc.edu
Ligand-mediated decrease of thyroid hormone receptor-{alpha} 1 in cardiomyocytes by proteosome- … - Full text - MIT Libraries
A Kenessey, K Ojamaa - Am J Physiol Heart Circ Physiol, 2005 - ajpheart.physiology.org
... Antibody to TR 1 (PAI-211A) was from Affinity BioReagents (Golden, CO), and TR 1/
1-antibody (C1) and TFIID (TATA box binding protein, TBP) were from Santa ...
Web Search - ajpheart.physiology.org - ncbi.nlm.nih.gov
The Rous Sarcoma Virus Long Terminal Repeat Promoter Is Regulated by TFII-I - Full text - MIT Libraries
CM Mobley, L Sealy - J Virol, 2000 - jvi.asm.org
... including USF (9, 44), RNA polymerase II (6, 41), TBP-associated factors (14 ... AdMLP
promoter, TFII-I acts independently and synergistically with USF1 to activate ...
Cited by 2 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
An Upstream Initiator-Like Element Suppresses Transcription of the Rat Luteinizing Hormone Receptor … - Full text - MIT Libraries
HS Youn, YB Koo, I Ji, TH Ji - Molecular Endocrinology - mend.endojournals.org
... YY1 binding element; TdT, TdT initiator) and the E-box (USF1 binding element). ... It
has been postulated that TBP-associated factors or initiator binding proteins ...
Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
Distinct Transcriptional Pathways Regulate Basal and Activated Major Histocompatibility Complex … - Full text - MIT Libraries
TK Howcroft, A Raval, JD Weissman, A Gegonne, DS … - Mol Cell Biol, 2003 - mcb.asm.org
... cotransfected into HeLa epithelial cells with either CIITA (2 µg) or USF1 (2 µg ...
Inr-like elements are not necessary for transcription, and no TBP binding has ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - utminers.utep.edu - ncbi.nlm.nih.gov - all 6 versions »
Role of the Transcription Start Site Core Region and Transcription Factor YY1 in Rous Sarcoma Virus … - Full text - MIT Libraries
CM Mobley, L Sealy - J Virol, 1998 - jvi.asm.org
... TFIID is a multisubunit complex consisting of TATA-binding protein (TBP)
and several TBP-associated factors (TAFs) (27). The TBP ...
Cited by 6 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Transcription by RNA polymerase I
KM Hannan, RD Hannan, LI Rothblum, LI Rothblum - Front. Biosci, 1998 - bioscience.org
... This is exemplified by the utilization of TBP as a component of SL-1 and the
role of Rb in regulatory rDNA transcription. 2. INTRODUCTION ...
Cited by 41 - View as HTML - Web Search - bioscience.mirror.ac.cn - xylian.igh.cnrs.fr - ncbi.nlm.nih.gov - all 8 versions » - Get it from MIT Libraries
THE ROLE OF PU. 1 IN B-LYMPHOCYTE DEVELOPMENT AND FUNCTION
S RAO, MC SIMON - doi.wiley.com
... CD20 TTTCAAGAAGTGAAACCTGG Pip, USF1 Himmelmann et al., 1997 ... The N-terminus of
PU.1, (aa 1—75), also interacts with TATA-binding protein (TBP) and the ...
Web Search
Transcriptional regulation by the MAP kinase signaling cascades - Full text - MIT Libraries
SH Yang, AD Sharrocks, AJ Whitmarsh - Gene, 2003 - www-unix.oit.umass.edu
... bHLH BMAL1 ERK 31 USF1 p38 32 c-Myc ERK, JNK, ERK5 33–35 Mi (MITF) ... HSF-1 ERK, JNK
65, 66 Pax6, TBP ERK, p38 67–69 p53, SMAD3 ERK, JNK, p38 70–74 TIF-1A ...
Cited by 48 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
The Role of Sp 1 and AP-2 in Basal and Protein Kinase A-induced Expression of Mitochondrial Serine: … - Full text - MIT Libraries
C Uchida, T Oda, T Sugiyama, S Otani, M Kitagawa, … - J Biol Chem, 2002 - jbc.org
... Indeed, overexpression of CREB, AP-1, and TBP (TATA-box binding protein) was not
effective ... 2 may serve as an initiator-like factor, such as YY-1, USF1, or TFII ...
Cited by 5 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
DNA bending and wrapping around RNA polymerase: a'revolutionary' model describing transcriptional … - Full text - MIT Libraries
B Coulombe, ZF Burton - Microbiology and Molecular Biology Reviews, 1999 - mmbr.asm.org
... The DNA-wrapping model describes specific roles for general RNA polymerase II
transcription factors (TATA-binding protein [TBP], TFIIB, TFIIF, TFIIE, and TFIIH ...
Cited by 41 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - csa.com - all 5 versions »
hnRNP K Binds a Core Polypyrimidine Element in the Eukaryotic Translation Initiation Factor 4E (eIF4 …
M Lynch, L Chen, MJ Ravitz, S Mehtani, K Korenblat … - mcb.asm.org
... Utilization of the TATA-binding protein (TBP) is common to promoters
transcribed by all RNA polymerases (106). TBP is present in ...
Web Search - mcb.asm.org
Regulation of nuclear localization and transcriptional activity of TFII-I by Bruton's tyrosine … - Full text - MIT Libraries
CD Novina, S Kumar, U Bajpai, V Cheriyath, K Zhang … - Mol. Cell. Biol, 1999 - mcb.asm.org
... The purity of the cytoplasmic extracts was checked by Western blot analysis with
an anti-TBP antibody, and they were found to be free of nuclear contamination ...
Cited by 43 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Critical role of C/EBPdelta and C/EBPbeta factors in the stimulation of the cyclooxygenase-2 gene … - Full text - MIT Libraries
B Thomas, F Berenbaum, L Humbert, H Bian, G … - European Journal of Biochemistry, 2000 - content.febsjournal.org
... Biotechnology (USA). The antibodies to USF1 and USF2 were gifts from M.
Raymondjean (ICGM Cochin, Paris, France). Chondrocyte cultures ...
Cited by 17 - Cached - Web Search - ejbiochem.org - blackwell-synergy.com - ncbi.nlm.nih.gov - all 6 versions »
Escape of human cytomegalovirus from HLA-DR-restricted CD4 T-cell response is mediated by repression … - Full text - MIT Libraries
E Le Roy, A Muhlethaler-Mottet, C Davrinche, B … - J Virol, 1999 - jvi.asm.org
... A TBP probe was used as an internal control. ... functional activity of STAT1 through
interaction with other transcriptional factors such as USF1 (34) may be ...
Cited by 30 - Web Search - jvi.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Molecular and Functional Interactions of Transcription Factor USF with the Long Terminal Repeat of …
L KANG, A FALASCHI, M GIACCA - Journal OF Virology, 1995 - jvi.asm.org
... For the experiments with purified USF, the primers for amplifications were FOOTP
(5 -GCAAGCTTGAAGAGGCCAAT-3 ) and USF1 (5 -AGCAAGCTCGAT GTCAGCAGTTCTT-3 ); for ...
Cited by 14 - Web Search - jvi.asm.org - pubmedcentral.nih.gov - Get it from MIT Libraries
Cloning and Functional Analysis of the Human IRF-3 Promoter
WJ Lowther, PA Moore, KC Carter, PM Pitha - DNA and Cell Biology, 1999 - dx.doi.org
... of many constitutively expressed genes and can serve as a TBP site in ... E-box-bind-
ing protein, TFII-I, that interacts physically and functionally with USF1. ...
Cited by 15 - Web Search - liebertonline.com - liebertonline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Application of Genomic Resources and Gene Expression Profiles to Identify Genes That Regulate Bone …
W Gu, XM Li, BA Roe, KH Lau, B Edderkaoui, S Mohan … - Current Genomics, 2003 - ingentaconnect.com
Page 1. Current Genomics, 2003, 4, 75-102 75 1389-2029/03 $41.00+.00 ©2003
Bentham Science Publishers Application of Genomic Resources ...
Cited by 1 - Web Search
DNA Bending and Wrapping around RNA Polymerase: a “Revolutionary” Model Describing …
HAMRNA POLYMERASES, T MECHANISM, TT FACTORS - www-lehre.img.bio.uni-goettingen.de
... TFA/TBP binds to a TATA recognition element in the upstream promoter region. ...
In eukaryotes, TBP binds to the TATA box of the promoter (12). ...
View as HTML - Web Search - biology.ualberta.ca - gaea.bch.msu.edu - bch.msu.edu - all 5 versions »
Critical role of C/EBPD and C/EBPb factors in the stimulation of the cyclooxygenase-2 gene … - Full text - MIT Libraries
B Thomas, F Berenbaum, L Humbert, H BIAN, G … - Eur J Biochem, 2000 - ingentaconnect.com
... Biotechnology (USA). The antibodies to USF1 and USF2 were gifts from M.
Raymondjean (ICGM Cochin, Paris, France). Chondrocyte cultures ...
Cited by 18 - Web Search
Rapid Generation of de novo Biological Pathways from Large-Scale Gene Expression Data Using the …
DC Siu - ingenuity.com
... FYN, SYK COL1A2, DNTT,TNC, CDC4, TGFBR2, SP1, SP3, PSG1, ERG, USF1, ETS1, FLI1 ... PBX1,
SPP1, MEIS1, MADH1, MADH4, MLL, CHD4, SMARCA2, TAF6, SIN3A, TBP, Histone H3 ...
View as HTML - Web Search
Transcriptional regulation of the human apolipoprotein genes
VI Zannis, HY Kan, A Kritis, E Zanni, D Kardassis - Frontiers in Bioscience, 2001 - xylian.igh.cnrs.fr
... USF1 and USF2a,2b are encoded by two different genes, USF2a and USF2b are generated ...
TFIID general factor is a complex of TATA box binding protein (TBP) and at ...
Cited by 17 - Cached - Web Search - bioscience.org - bioscience.org - ncbi.nlm.nih.gov - all 8 versions » - Get it from MIT Libraries
Did you mean to search for: TBP and US F1
|
©2005 Google