![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 11 of 11 for TCF1 and EGR1. (0.07 seconds) |
Development of artificial chimerical gene regulatory elements specific for cancer gene therapy - Full text - MIT Libraries
JHO SHIN, J YI, YJIN LEE, A KIM, M PARK, SH KIM, H … - ONCOLOGY REPORTS, 2003 - virology.med.uoc.gr
... T, hTert promoter; E, Tcf1 · enhancer ... minimal promoter/enhancer elements, by showing
that a synthetic enhancer containing four copies of the Egr1 gene enhancer ...
View as HTML - Web Search - 147.52.72.117 - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Online Table: Mouse mutations causing reproductive defects. Only single mutant defects are described …
M gene Sex, RPFS References, MS degeneration … - Infertility - nature.com
... Infertility 76 Early growth response 1 (Egr1) targeted neo insertion ... Hepatocyte
nuclear factor (HNF- 1α)(transcription factor 1; Tcf1) ...
View as HTML - Web Search - tu-cottbus.de
GEArray Q Series Mouse Signal Transduction in Cancer Gene Array: AR-SAMM-044
FG Grouping, A Pathway, C Cdk, E Pathway, B Bcl, H … - eurogentec.be
... MAP Kinase Pathway: Col1a1 (Collagen I), Egr1 (egr-1), Fos (c-fos), Jun (c-jun). ...
Fosl1 (Fra-1), Idb2, Jun (c-jun), Mmp7, Myc (c-myc), Vegfa, Tcf1, Wisp1. ...
View as HTML - Web Search - eurogentec.com
Gene for a tissue-specific transcriptional activator(EBF or Olf-1), expressed in early B lymphocytes …
A Milatovich, RG Qiu, R Grosschedl, U Francke - Mammalian Genome, 1994 - springerlink.com
... of loci is interrupted on 5q between the proximal IL3,4,5/IRF1/TCF1/CSF2 cluster ...
their homologs on mouse Chr 18 (GRL, ADBR2, DHLAG, CD14, RPS 14, EGR1, LOX, FBN2 ...
Cited by 7 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Gene Expression Profiling Following In Utero Exposure to Phthalate Esters Reveals New Gene Targets … - Full text - MIT Libraries
K Liu, KP Lehmann, M Sar, SS Young, KW Gaido - BIOLOGY OF REPRODUCTION, 2005 - biolreprod.org
... regulated (Nfil3), is nuclear receptor subfamily 4, group A, member 1 (Nr4a1, also
293 known as NGFI-B), and transcription factor 1 (Tcf1, also known as Hnf-1 ...
Cited by 1 - Web Search - biolreprod.org - ncbi.nlm.nih.gov
Analysis of Transcription Factor Expression during Discrete Stages of Postnatal Thymocyte … - Full text - MIT Libraries
S Tabrizifard, A Olaru, J Plotkin, M Fallahi- … - The Journal of Immunology, 2004 - jimmunol.org
... Egr1: forward, CAGGAGTGATGAACGCAAGA; reverse, TGGGGATGGGTAAGAAGAGA. ... 2). In Tcf1 mutant
mice (36), differentiation is impaired just before the DP stage, a stage ...
Cited by 1 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
A novel method of gene transcript profiling in airway biopsy homogenates reveals increased … - Full text - MIT Libraries
GM Dolganov, PG Woodruff, AA Novikov, Y Zhang, RE … - Genome Res, 2001 - asthmagenomics.ucsf.edu
... Transcription factor 1 (TCF1) NM_003202.1 1.08E+07 2.93E+06 3.67 0.24 ... Early growth
response 1 (EGR1) NM_001964 3.54E+09 3.18E+09 1.11 0.84 ...
Cited by 25 - View as HTML - Web Search - ncbi.nlm.nih.gov
Leaving the neighborhood: molecular mechanisms involved during epithelial-mesenchymal transition - Full text - MIT Libraries
P Savagner - BioEssays, 2001 - doi.wiley.com
Page 1. Leaving the neighborhood: molecular mechanisms involved during
epithelial-mesenchymal transition P. Savagner Summary Several ...
Cited by 97 - Web Search - doi.wiley.com - jexpclinassistreprod.com - ncbi.nlm.nih.gov
Genetic dissection of mammalian fertility pathways - Full text - MIT Libraries
MM Matzuk, DJ Lamb - Nature Cell Biology, 2002 - mrg.genetics.washington.edu
Page 1. s41 Genetic dissection of mammalian fertility pathways Martin M.
Matzuk*†‡#and Dolores J. Lamb†§ Departments of *Pathology ...
Cited by 60 - View as HTML - Web Search - nature.com - tu-cottbus.de - ncbi.nlm.nih.gov - all 5 versions »
JBC Papers in Press. Published on October 24, 2001 as Manuscript M107795200
C Kumar-Sinha, S Varambally, A Sreekumar, AM … - jbc.org
Page 1. Molecular Cross-Talk Between the TRAIL and Interferon Signaling Pathways
Chandan Kumar-Sinha, Sooryanarayana Varambally, Arun ...
Web Search
Evaluation of the host transcriptional response to human cytomegalovirus infection - Full text - MIT Libraries
JF Challacombe, A Rechtsteiner, R Gottardo, LM … - Physiological Genomics, 2004 - physiolgenomics.physiology.org
Page 1. Evaluation of the host transcriptional response to human cytomegalovirus
infection Jean F. Challacombe 1 , Andreas Rechtsteiner ...
Web Search - stat.washington.edu - intl-physiolgenomics.physiology.org - ncbi.nlm.nih.gov - all 6 versions »
|
©2005 Google