![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 44 of 44 for TP53 and HOXA9. (0.10 seconds) |
A novel gene, MSI2, encoding a putative RNA-binding protein is recurrently rearranged at disease … - Full text - MIT Libraries
A Barbouti, M Hoglund, B Johansson, C Lassen, PG … - Cancer Res, 2003 - cancerres.aacrjournals.org
... genetic studies have mostly focused on well-known tumor suppressor genes (eg, TP53,
CDKN2A, and ... t(3;21)(q26;q22)/RUNX1-EVI1, t(7;11)(p15;p15)/NUP98-HOXA9, t(8 ...
Cited by 8 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov - lu-research.lub.lu.se - all 5 versions »
Therapy Related MDS and AML Amplification or duplication of chromosome band 21q22 with multiple …
MK Andersen, DH Christiansen, J Pedersen-Bjergaard - Leukemia, 2005 - nature.com
... of these drugs, that is, DNA breakage and induction of mutation of TP53. ... of function,
as it was associated with increased expression of HOXA9, a downstream ...
Web Search - nature.com
Amplification or duplication of chromosome band 21q22 with multiple copies of the
MK Andersen, DH Christiansen, J Pedersen-Bjergaard - Leukemia, 2005 - nature.com
... of these drugs, that is, DNA breakage and induction of mutation of TP53. ... of function,
as it was associated with increased expression of HOXA9, a downstream ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
NUP 98 gene rearrangements and the clonal evolution of chronic myelogenous leukemia
HG Ahuja, L Popplewell, L Tcheurekdjian, ML Slovak - Genes Chromosomes and Cancer, 2001 - doi.wiley.com
... The fusion points were similar to previously reported NUP98-HOXA9 fusion points
from ... These include rearrangements/mutations of the TP53 gene in 20–30% of ...
Cited by 21 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Lineage infidelity of epithelial ovarian cancers is controlled by HOX genes that specify regional … - Full text - MIT Libraries
W Cheng, J Liu, H Yoshida, D Rosen, H Naora - Nature Medicine, 2005 - nature.com
... Tp53 deficiency plus activation of two of the oncogenes Myc, Kras and Akt1 ... The tandemly
arranged mammalian Hoxa9, Hoxa10 and Hoxa11 genes are related to the ...
Cited by 2 - Web Search - nature.com - ncbi.nlm.nih.gov
human lung adenocarcinomas - Full text - MIT Libraries
M Shiraishi, A Sekiguchi, AJ Oates, MJ Terry, Y … - Oncogene, 2002 - nature.com
... HOXA9 a AC004080 42 705 ± 43 419 42 612 ± 43 832 ACCCTACCTGCTGTGACCAG 94 ... TP53 gene
and the gene is inactivated by CpG island methylation (Raman et al., 2000 ...
Cited by 7 - Web Search - nature.com - ncbi.nlm.nih.gov
Multicolor COBRA-FISH analysis of chronic myeloid leukemia reveals novel cryptic balanced …
A Barbouti, B Johansson, M Hoeglund, N Mauritzson, … - Genes Chromosomes and Cancer, 2002 - doi.wiley.com
... BC have mainly focused on alterations of well-known tumor-suppressor genes (eg,
TP53, CDKN2A, and ... 3;21)(q26;q22)/CBFA2-EVI1, t(7;11)(p15; p15)/NUP98-HOXA9, t(8 ...
Cited by 6 - Web Search - lu-research.lub.lu.se - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Text-Based Gene Profiling with Domain-Specific Views
P Glenisson, B Coessens, SV Vooren, Y Moreau, BD … - SWDB, 2003 - cs.uic.edu
... Genes, however, are not only referred to by their symbols (eg, TP53), but often
also by their full name, typically constituting a phrase ... HOXA9 3205 NRF 55922 ...
Cited by 1 - View as HTML - Web Search
Genetic pathways in therapy-related myelodysplasia and acute myeloid leukemia - Full text - MIT Libraries
J Pedersen-Bjergaard, MK Andersen, DH Christiansen … - Blood, 2002 - bloodjournal.org
... MDS and AML, and is closely related to mutation of the TP53 gene and to ... myeloid
leukaemia fuses the genes for nycleoporin NUP98 and class I homeoprotein HOXA9. ...
Cited by 35 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov
Prognostic value of cytogenetic findings in adults with acute myeloid leukemia
K Mrozek, K Heinonen, CD Bloomfield - Int J Hematol, 2000 - static.cjp.com
... The only exception is the TP53 gene found to be inactivated in many patients with
AML (and ... 11p15 t(6;9)(p23;q34)† DEK-CAN t(7;11)(p15;p15)† HOXA9-NUP98 inv ...
Cited by 19 - View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
[CITATION] Acute Lymphoblastic Leukemia
MG Alterations
Web Search
High-resolution detection and mapping of genomic DNA alterations in neuroblastoma.
YP Mosse, J Greshock, A Margolin, T Naylor, K Cole … - GENES, CHROMOSOMES & CANCER, 2005 - doi.wiley.com
... Q-PCR with primer/probe pairs to MPO (17q23) referenced to TP53 (17p13) as ... gene cluster
includes HOXA1, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXA10, HOXA11 ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
G ENETIC P ROFILE OF A CUTE M YELOID L EUKEMIA - Full text - MIT Libraries
C Mecucci, R Rosati, R La Starza - Reviews in Clinical & Experimental Hematology, 2002 - blackwell-synergy.com
... The leukemogenic potential of NUP98/HOXA9 protein was tested in vitro by ... as complete
loss or interstitial deletion of chromosome 5q, and mutations of TP53. ...
Cited by 4 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Cytogenetic and Molecular Genetic Evolution of Chronic Myeloid Leukemia
A Haematologica - Acta Haematologica, 2002 - content.karger.com
... In conclusion, TP53 mutations are undoubtedly involved in the progression of some
CML ... in CML, namely CBFA2/ETO, CBFB/MYH11, and NUP98/HOXA9, corresponding to t ...
Web Search - dx.doi.org - content.karger.com - karger.com
Cytogenetic and Molecular Genetic Evolution of Philadelphia-Chromosome-Positive Chronic Myeloid …
BJTFF Mitelman - content.karger.com
... of the BCR/ABL transcript, up-regula- tion of the EVI1 gene, increased telomerase
activity, and muta- tions of the tumour suppressor genes RB1, TP53, and CDKN2A ...
Web Search - content.karger.com
An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes … - Full text - MIT Libraries
JG Thomas, JM Olson, SJ Tapscott, LP Zhao - METHODS, 2001 - genome.org
... of clustered breakpoints in 17p11 and is not associated with coding TP53 mutations ...
Frequent co-expression of the HOXA9 and MEIS1 homeobox genes in human myeloid ...
Cited by 86 - Web Search - sullivan.bu.edu - vision.ime.usp.br - xobi.net - all 10 versions »
Comprehensive genotypic analysis of leukemia: clinical and therapeutic implications
L Kelly, J Clark, DG Gilliland - Curr. Opin. Oncol, 2002 - co-oncology.com
... Examples include the concurrence of t(9;22)(q34;q22) and t(7;11)(p15;p15)
translocations giving rise to the BCR/ABL and NUP98/HOXA9 fusions associated with ...
Cited by 11 - Web Search - siteman.wustl.edu - co-oncology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
G ENETICS OF M YELOID L EUKEMIAS - Full text - MIT Libraries
LM Kelly, DG Gilliland - Annual Review of Genomics and Human Genetics, 2002 - genom.annualreviews.org
... For example, some cases of BCR/ABL-positive CML progress to AML with acquisition
of at[7;11] resulting in expression of a NUP98/HOXA9 fusion gene (3, 100). ...
Cited by 35 - Web Search - 128.194.251.107 - fluid.annualreviews.org - ncbi.nlm.nih.gov - all 5 versions »
Cytogenetic and Molecular Genetic Evolution of Chronic Myeloid Leukemia
BJTFF Mitelman - Acta Haematol, 2002 - content.karger.com
... of the BCR/ABL transcript, upregulation of the EVI1 gene, increased telomerase activity,
and muta- tions of the tumor suppressor genes RB1, TP53, and CDKN2A. ...
Web Search - content.karger.com - cmlsupport.com
The biology of CML blast crisis - Full text - MIT Libraries
C Cycle, S Transduction, G Expression - Blood, 2004 - bloodjournal.org
... Two other genes up-regulated by BCR/ABL in CML-BC are Evi-1 and HOXA9, 2 transcription
factors that can cooperate with BCR/ABL in blocking myeloid ...
Web Search - dx.doi.org - bloodjournal.org
Somatic activation of oncogenic Kras in hematopoietic cells initiates a rapidly fatal … - Full text - MIT Libraries
BS Braun, DA Tuveson, N Kong, DT Le, SC Kogan, J … - Proc Natl Acad Sci US A, 2004 - pubmedcentral.nih.gov
... senescence, which can be overcome by mutating Ink4a or Tp53 (5). These data ... by
translocations involving transcription factors such as AML1 or HOXA9 (46, 47). ...
Cited by 20 - Web Search - dx.doi.org - pnas.org - ncbi.nlm.nih.gov - all 6 versions »
Microarrays as Cancer Keys: An Array of Possibilities - Full text - MIT Libraries
S Mohr, GD Leikauf, G Keith, BH Rihn - Journal of Clinical Oncology, 2002 - jco.org
... Medline]; Wen WH, Bernstein L, Lescallett J, et al: Comparison of TP53 mutations
identified ... Feinstein E, Mor O, et al: Upregulation of Meis1 and HoxA9 in acute ...
Cited by 30 - Web Search - dx.doi.org - jco.org - ncbi.nlm.nih.gov - all 5 versions »
Leukemias related to treatment with DNA topoisomerase II inhibitors
CA Felix - Medical and Pediatric Oncology, 2001 - doi.wiley.com
... products. These include the homeobox genes PMX1 at band 1p15 [151], HOXD13
at band 2q31 [147] and HOXA9 at band 7p15 [149,150]. ...
Cited by 34 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Transcript map of the 3.7-Mb D19S112-D19S246 candidate tumor suppressor region on the long arm of … - Full text - MIT Libraries
C Hartmann, L Johnk, G Kitange, Y Wu, LK Ashworth, … - Cancer Res, 2002 - cancerres.aacrjournals.org
... tumor suppressor gene, depending on type and location of the mutation (eg, TP53). ...
Overexpression of this gene, along with the presence of Hoxa9, induced acute ...
Cited by 10 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Mechanisms of BCR–ABL in the pathogenesis of chronic myelogenous leukaemia - Full text - MIT Libraries
R Ren - Nature Reviews Cancer, 2005 - nature.com
... a BMT model that expressed both the BCR–ABL and NUP98–HOXA9 fusion proteins ... isolated
from patients with blast-phase CML include mutations in TP53, RB, and ...
Cited by 2 - Web Search - nature.com - ncbi.nlm.nih.gov
Molecular Cytogenetic Aspects of Hematological Malignancies: Clinical Implications
Z CHEN, AA SANDBERG - American Journal of Medical Genetics (Semin. Med. Genet.), 2002 - doi.wiley.com
... crisis. Mole- cularly, the TP53 gene appears to be affected in about 30%
of cases of myeloid blast transformation [Cline, 1994]. ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Aberrant expression of the LHX4 LIM-homeobox gene caused by t (1; 14)(q25; q32) in chronic …
M Yamaguchi, K Yamamoto, O Miura - GENES, CHROMOSOMES & CANCER, 2003 - doi.wiley.com
... to accompany the disease progression, including aberrations of TP53, RB, CDKN2A,
and ... ation by SCF: potential mechanisms of cooperativity with Hoxa9 in myeloid ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
De la cytogenetique a la cytogenomique des tumeurs: le point en 2004
A Bernheim, JL Huret, M Guillaud-Bataille, O … - Bull Cancer, 2004 - john-libbey-eurotext.fr
... t(5;12)(q33;p13) PDGFRB-ETV6 -5 ou del(5q) t(6;9)(p23;q34) DEK-NUP214 t(7;11)(p15;
p15) HOXA9-NUP98 -7 ... Côlon del(17p), TP53 -18 DCC ouDPC4/SMAD4 del(5q21)* APC ...
View as HTML - Web Search - john-libbey-eurotext.fr
[BOOK] Molecular Biology in Cancer Medicine
R Kurzrock, M Talpaz - 1999 - print.google.com
Page 1. Molecular Biology in Cancer Medicine Th ie One Ii1 IIIIIIiIUflhIIIbII fli
YV_ Q 1 .. AOA Page 2. Molecular Biology in Cancer Medicine Edited by ...
Web Search - Get it from MIT Libraries - Library Search
6 RECURRING CHROMOSOME REARRANGEMENTS IN HUMAN CANCER
OI Olopade, OM Sobulo, JD Rowley - cancer.org
... q13) AML t(3;3)(q21;q26) RPN1-EVI1 Or inv(3)(q21;q26)\ t(3;5)(q21;q31)
t(3;5)(q25;q34) MLF1-NPM1 t(6;9)(p23;q34) DEK-CAN (NUP214) t(7;11)(p15;p15) HOXA9- ...
View as HTML - Web Search
SEROLOGIC ANALYSIS OF OVARIAN TUMOR ANTIGENS REVEALS A BIAS TOWARD ANTIGENS ENCODED ON 17q - Full text - MIT Libraries
N Urban, K O’Briant, BH Nelson - Int. J. Cancer, 2003 - doi.wiley.com
... n 20) H3907 p53 p53 TP53 2 4 0 H3907 Topoisomerase II TOP2A TOP2A 2 1 0 H3907
Putative helicase RUVBL RUVBL WH1P 2 0 0 H3907 Nucleolar ...
Cited by 6 - Web Search - ncbi.nlm.nih.gov
The Comprehensive Mouse Radiation Hybrid Map Densely Cross-Referenced to the Recombination Map: A … - Full text - MIT Libraries
LB Rowe, ME Barter, JA Kelmenson, JT Eppig - Genome Research, 2003 - genome.org
... end of Chr 9. Note that AA987181 is an EST for Hoxa9, which has ... The functional
significance of absence: The chromosomal segment harboring Tp53 is absent from ...
Cited by 11 - Web Search - genome.org - pubmedcentral.nih.gov - dx.doi.org - all 7 versions »
Bibliography Current World Literature
MR Baer, LA Pixley, LA Ford… - Current Opinion in Oncology, 2002 - co-oncology.com
... J, Nakamura T, Croce CM, et al.: Upregulation of Meis1 and HoxA9 in acute ... S, Appelbaum
FR, Slovak ML, Willman CL, Radich JP: FLT3, RAS, and TP53 mutations in ...
Web Search - co-rheumatology.com - co-gastroenterology.com - co-endocrinology.com - all 9 versions »
Pathogenesis of acute myeloid leukaemia and inv (16)(p 13; q 22): a paradigm for understanding … - Full text - MIT Libraries
JT Reilly - British Journal of Haematology, 2005 - blackwell-synergy.com
... mutations, namely PML RARA (Scolnik et al, 1998), AML1 ETO (Ferro et al, 1992; Kojima
et al, 1999), AML1-EVI1 (Cuenco & Ren, 2001) and NUP98 HOXA9 (Yamamoto et ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
[BOOK] Molecular biology of cancer
F Macdonald, CHJ Ford, AG Casson - 2004 - print.google.com
... 40 3.4 TPS3 (p53) 41 3.4.1 The TPS3 gene and its protein productp53 41 3.4.2 Activation
of TP53 42 3.4.3 Activatedp53 responses — cell cycle inhibition 44 ...
Cited by 10 - Web Search - Get it from MIT Libraries - Library Search
Cancer Genomics and Molecular Pattern Recognition
C Genomics, BD Analysis - broad.mit.edu
... 5 1.98 U27333 Alpha-1,3 fucosyltransferase 6 (FCT3A) 6 1.81 X56494 PKM2 Pyruvate
kinase, muscle 7 1.78 X59798 CCND1 Cyclin D1 8 1.67 M22898 TP53 Tumor protein ...
View as HTML - Web Search - sib-dea.unil.ch
Epigenetics and cancer - Full text - MIT Libraries
AH Lund, M van Lohuizen - Genes & Development, 2004 - genesdev.org
... Intriguingly, the known MLL target genes HoxA7 and HoxA9 are both required for leukemia
induction by an MLL fusion oncogene (Ayton and Cleary 2003 ). ...
Cited by 11 - Web Search - dx.doi.org - genesdev.org - ncbi.nlm.nih.gov
Gene expression profiling and its application in studies of haematological malignancy - Full text - MIT Libraries
M Hubank - British Journal of Haematology, 2004 - blackwell-synergy.com
Full Article. View/Print PDF article (438K). Download to reference manager.
British Journal of Haematology Volume 124 Issue 5 Page ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
POSTER SESSION I
CD Baldus, SM Tanner, A Ruppert, SP Whitman, G … - springerlink.com
... on the following chromosome arms: 2p (n=2, hMSH2), 5q (n=9, APC), 7q (n=5, D5486,
c-met), 8q (n=8, Eto), 11q (n=6, MLL), 17q (n=6, BRCA1), 17p (n=3, TP53). ...
Web Search
Bibliography Current World Literature
L Benboubker, H Watier, A Carion, MT Georget, I … - Current Opinion in Hematology, 2002 - co-hematology.com
... Fujino T, Yamazaki Y, Largaespada DA, Jenkins NA, Copeland NG, Hirokawa K, Nakamura
T: Inhibition of myeloid differentiation by Hoxa9, Hoxb8, and Meis homeobox ...
Web Search
Molecular Pattern Recognition with GeneCluster 2: Tutorial and Examples
P Tamayo, M Reich, K Ohm, A Subramanian, K Ross, S … - ifom-ieo-campus.it
Page 1. 1 Molecular Pattern Recognition with GeneCluster 2: Tutorial and
Examples Pablo Tamayo, Michael Reich, Keith Ohm, Aravind ...
View as HTML - Web Search - ifom-firc.it
Bibliography Current World Literature
H Ashush, LA Rozenszajn, M Blass, M Barda-Saad, D … - Current Opinion in Oncology, 2001 - co-oncology.com
... chronic myeloid leukemia and in other hematologic malignancies is the result of
clustered breakpoints in 17p11 and is not associated with coding TP53 mutations ...
Web Search
[BOOK] Cytogenetic and molecular genetic changes in childhood acute leukaemias
T Niini - 2002 - ethesis.helsinki.fi
Page 1. Department of Medical Genetics Haartman Institute University of Helsinki
Finland Cytogenetic and Molecular Genetic Changes in Childhood Acute Leukaemias ...
View as HTML - Web Search - Get it from MIT Libraries - Library Search
Publicaties CME-UZ–UZ Leuven-1998-2004
S CLAES, T AGUIRRE, V SIMOSA, T BUSTOS, R LANDER, … - Am. J. Surg. Pathol, 1998 - uzleuven.be
Page 1. 1 CLAES, S., AGUIRRE, T., SIMOSA, V., BUSTOS, T., LANDER, R., PIRAS,
M., LEGIUS, E., CASSIMAN, JJ, RAEYMAEKERS, P. Hydrocephalus ...
View as HTML - Web Search
|
©2005 Google