![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 34 of 34 for USF1 and MYB. (0.09 seconds) |
Did you mean: US F1 and MYB
Regulation of the Murine D {delta} 2 Promoter by Upstream Stimulatory Factor 1, Runx1, and c-Myb - Full text - MIT Libraries
J Carabana, E Ortigoza, MS Krangel - The Journal of Immunology, 2005 - jimmunol.org
... View larger version (26K): [in this window] [in a new window], FIGURE 10. Runx1,
Myb, and USF1 are associated with the D 2 promoter in DN thymocytes in vivo. ...
Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Role of USF1 phosphorylation on cardiac alpha-myosin heavy chain promoter activity - Full text - MIT Libraries
Q Xiao, A Kenessey, K Ojamaa - Am J Physiol Heart Circ Physiol, 2002 - intl-ajpheart.physiology.org
... disrupt DNA binding as shown for Max, c-Myc, and c-Myb (2, 26 ... Rat USF1 contains three
protein kinase C (PKC) consensus phosphorylation sites within the leucine ...
Cited by 6 - Web Search - ajpheart.physiology.org - ajpheart.physiology.org - ncbi.nlm.nih.gov - all 5 versions »
CLONING, EXPRESSION, PURIFICATION AND CRYSTALLISATION OF THE HUMAN Ets-1/USF1/DNA COMPLEX & CRYSTAL …
FJ FERNENDEZ-PEREZ, P DOCTOR - tdx.cesca.es
... CLONING, EXPRESSION, PURIFICATION AND CRYSTALLISATION OF THE HUMAN Ets-1/USF1/DNA
COMPLEX & CRYSTAL STRUCTURE OF THERMOTOGA MARITIMA HISTIDINOL-PHOSPHATE ... USF1. ...
Web Search
BD™ TransFactor Kits Data Sheet
TISOF BD, TKITT FACTORS, PP THP, PP THP - clontech.com
... Max Myc/Max U-937 631937 631942 1 c-Myb c-Myb Jurkat 631937 1 c-Myc Myc/Max U-937
631937 631942 1 ... STAT3 Stat3 HepG2 (IL6) 631953 631952 USF1 USF U-937 631937 ...
View as HTML - Web Search
BD™ TransFactor Kits Data Sheet
TISOFT KIT, T FACTORS, PP THP, PP THP - clontech.com
... Max Myc/Max U-937 631937 631942 c-Myb c-Myb Jurkat 1 631937 c-Myc Myc/Max U-937 ... 631942
STAT1 Stat1 U-937 (IFN-γ) 1, 2 631917 631935 USF1 USF U-937 631937 ...
View as HTML - Web Search - bdbiosciences.com
A 69-Base Pair Fragment Derived from Human Transcobalamin II Promoter Is Sufficient for High … - Full text - MIT Libraries
N Li, B Seetharam - Journal of Biological Chemistry, 1998 - jbc.org
... with 1.5 µg of affinity purified rabbit polyclonal antibody against USF1, USF2,
or c ... several potential cis-elements, such as two AP2 sites, two Myb sites, and ...
Cited by 17 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
c-Myc Mediates Activation of the cad Promoter via a Post-RNA Polymerase II Recruitment Mechanism - Full text - MIT Libraries
SR Eberhardy, PJ Farnham - J Biol Chem, 2001 - jbc.org
... 1 g of anti-c-Myc sc-764-X (Santa Cruz), 1 l of anti-USF1 serum (a ... We also examined
another cell cycle-regulated promoter, b-myb, for RNAP II binding in U937 ...
Cited by 37 - Web Search - genomics.ucdavis.edu - mcardle.oncology.wisc.edu - ncbi.nlm.nih.gov - all 6 versions »
BD Mercury™ TransFactor Profiling Kit—Oncogenesis 3
BD Mercury - bdbiosciences.ca
... Oncogenesis 1 DP-1, E2F-1, Rb, p107, E2F-2, Sp-1 Oncogenesis 2 c-Myb, c-Myc, Max,
USF1, USF2, p53 Oncogenesis 3 HIF-1α, HIF-1β, Egr-1, c/EBP, Oct I, Oct II ...
View as HTML - Web Search - ebiotrade.com - bdbiosciences.com - clontech.com - all 6 versions »
BD Mercury™ TransFactor Family Kits
BDL Colours, DRP Antibody - bdbiosciences.ca
... Profiling Kit—Oncogenesis 1 (DP-1, E2F-1, Rb, p107, E2F-2, Sp-1) 96 rxns K2073-1
631936 Profiling Kit—Oncogenesis 2 (c-Myb, c-Myc, Max, USF1, USF2, p53) 96 ...
View as HTML - Web Search - bdbiosciences.ca
BD™ TransFactor Glass Array
S Gasket - bdbiosciences.com
... Oncogenesis 1 (DP-1, E2F-1, Rb, p107, E2F-2, Sp1) (#631936 or #K2073-1) • BD Mercury™
Profiling Kit—Oncogenesis 2 (c-Myb, c-Myc, Max, USF1, USF2, p53 ...
View as HTML - Web Search - clontech.com
PGC-1α: A Multifunctional Transcriptional Coactivator Involved in Human Metabolic Disorders
H Oberkofler, F Krempler, W Patsch - Current Genomics, 2004 - ingentaconnect.com
... has also been demonstrated to mediate binding of specific repressors such as upstream
stimulatory factors 1 and 2 (USF1/USF2) and p160 myb binding protein ...
Web Search
Functional analysis of the human annexin A5 gene promoter: a downstream DNA element and an upstream … - Full text - MIT Libraries
MT Carcedo, JM Iglesias, P Bances, RO Morgan, MP … - Biochem. J, 2001 - biochemj.org
... 20) at room temperature for 1 h, incubated with anti-USF1 as primary ... cis-elements
[eg activator protein (AP) 2, nuclear factor κB, Myb, xenobiotic response ...
Cited by 4 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Identification of Target Genes of Oncogenic Transcription Factors - Full text - MIT Libraries
KE Boyd, PJ Farnham - Proceedings of The Society for Experimental Biology and …, 1999 - ebmonline.org
... with the v-myb gene in the E26 retrovirus that expresses a GAG-MYB-ETS fusion ... Other
proteins such as USF1 and USF2, as well as TFE3 and TFEB, can bind to and ...
Cited by 14 - Web Search - ebmonline.org - ncbi.nlm.nih.gov
c-Myc target gene specificity is determined by a post-DNAbinding mechanism - Full text - MIT Libraries
KE Boyd, J Wells, J Gutman, SM Bartley, PJ Farnham - Mol. Cell. Biol, 2005 - dx.doi.org
... We further demonstrate that although both Myc and USF1 can bind to cad, the ... Activates
the Recombination-Activating Gene-2 Promoter Together with c-Myb and Pax ...
Cited by 129 - Web Search - pnas.org - mcardle.oncology.wisc.edu - genomics.ucdavis.edu - all 10 versions »
Identification of Target Genes of Oncogenic Transcription Factors (44425)
KE Boyd, PJ Farnham - ingentaconnect.com
... with the v-myb gene in the E26 retrovirus that expresses a GAG- MYB-ETS fusion ... Other
pro- teins such as USF1 and USF2, as well as TFE3 and TFEB, can bind to ...
Web Search - genomics.ucdavis.edu - mcardle.oncology.wisc.edu
T-cell Expression of the Human GATA-3 Gene Is Regulated by a Non-lineage-specific Silencer - Full text - MIT Libraries
JM Gregoire, PH Romeo - J Biol Chem, 1999 - jbc.org
... 8D, lanes 2 and 3). Finally, antibodies against human USF1 or USF2 basic ... the regulation
of muscle differentiation (31), whereas it impairs the myb-ets synergy ...
Cited by 18 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
Activation of the Epstein-Barr virus DNA polymerase promoter by the BRLF1 immediate-early protein is … - Full text - MIT Libraries
C Liu, ND Sista, JS Pagano - J. Virol, 1996 - jvi.asm.org
... polyclonal antibody (a gift of Michelle Sawadogo) which recognizes both USF1 and ...
In addition, c-myb, a cellular transcriptional activator, has been shown to ...
Cited by 21 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Interferon-gamma regulation of the human mimecan promoter - Full text - MIT Libraries
ES Tasheva, GW Conrad - Mol Vis, 2003 - molvis.org
... the indicated amounts of pcDNA3.1/hIRF1, pCDM8/h-IRF-2, or pCX-USF1 expression plasmids ...
and IRF-2 to an ISRE located in the first intron of the c-myb gene has ...
Cited by 2 - View as HTML - Web Search - molvis.org - ncbi.nlm.nih.gov
Expression of the Microphthalmia-associated Basic Helix-Loop-Helix Leucine Zipper Transcription … - Full text - MIT Libraries
N Planque, N Turque, K Opdecamp, M Bailly, P … - Cell Growth & Differentiation, 1999 - cgd.aacrjournals.org
... induce a FGF2 response of cells, such as Fos, Jun, Ski, E1A, myb, myb-ets, and ... and
the LE-USF was constructed by inserting the EcoRI Human USF1 (27) fragment ...
Cited by 15 - Web Search - cgd.aacrjournals.org - ncbi.nlm.nih.gov
Novel transcription factors in human CD34 antigen-positive hematopoietic cells - Full text - MIT Libraries
I Gomes, TT Sharma, S Edassery, N Fulton, BG Mar, … - Blood, 2002 - bloodjournal.org
Page 1. HEMATOPOIESIS Novel transcription factors in human CD34 antigen–positive
hematopoietic cells Ignatius Gomes, Tiffany T. Sharma ...
Cited by 3 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
Targeting of the transcription factor Max during apoptosis: phosphorylation-regulated cleavage by … - Full text - MIT Libraries
A Krippner-Heidenreich, RV Talanian, R Sekul, R … - Biochem. J, 2001 - biochemj.org
... Only late in response to α-Fas was a decrease in c-Myc and c-Myb observed, probably ...
C) RK13 cells were transiently transfected with an USF1 expression plasmid ...
Cited by 24 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
DNA Binding of Myc/Max/Mad Network Complexes to Oligonucleotides Containing Two E Box Elements: c- …
J Vervoorts, B Luescher - Biological Chemistry, 1999 - degruyter.com
... transcriptional reg- ulators bind to Myc E box sequences, including USF1, USF2,
TFE3 ... Regulation of transcription factors c-Myc, Max, and c-Myb by casein kinase ...
Cited by 1 - Web Search - extenza-eps.com - degruyter.de - dx.doi.org - all 8 versions »
Clontechniques
CPA II, BD In-Fusion, PCRC Kit - bdbiosciences.com
Page 1. BD Biosciences Clontech Discovery Labware Immunocytometry Systems Pharmingen
October 2002 Highlights BD Atlas ™ Plastic Human 12K Microarray . . . . . ...
View as HTML - Web Search - ebiotrade.com - clontech.com
Clontechniques Canada
CPA II, BD In-Fusion, PCRC Kit - bdbiosciences.ca
Page 1. BD Biosciences Clontech Discovery Labware Immunocytometry Systems Pharmingen
Fall 2002 Highlights BD Atlas ™ Plastic Human 12K Microarray . . . . . ...
View as HTML - Web Search
ETS-core binding factor: a common composite motif in antigen receptor gene enhancers - Full text - MIT Libraries
B Erman, M Cortes, BS Nikolajczyk, NA Speck, R Sen - Mol. Cell. Biol, 1998 - mcb.asm.org
... and 10, GST-TFE3 (50 ng); and lanes 11 and 12, GST-USF1 (40 ng ... c-Myb and core-binding
factor/PEBP2 display functional synergy but bind independently to adjacent ...
Cited by 30 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
c-Myc inhibits CD11a and CD11c leukocyte integrin promoters
C Lopez-Rodrıguez, MD Delgado, A Puig-Kroeger, AL … - doi.wiley.com
... containing mutations at PU1-5/Inr, AP1-60, Sp1-70, CEBP-80, Myb-85, Sp1 ... E-box-binding
pro- teins, TFII-I, that interacts physically and functionally with USF1. ...
Cited by 3 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Purification of General RNA Polymerase II Transcription Factors from Mouse for Studies of …
I Kotova - diva-portal.org
... However, USF1 was inactive and NF-Y had a repressing effect in this system ... 17
transcription factors such as Gcn4, c-Jun, c-Fos, E2F1, c-Myb, nuclear hormone ...
Web Search - publications.uu.se
Recent advances in the identification of genetic and biochemical components of breast cancer …
MK Sauer - Curr Genomics, 2002 - ingentaconnect.com
... Sp1 ? Transrepression? (IGF-IR-resp.) transactivation [145] BRCA2 TFs USF1/2 NT
-66 to +129 Activation Promoter mapping/transactivation; EMSA [31] ...
Cited by 1 - Web Search
Overlapping CRE and E Box Motifs in the Enhancer Sequences of the Bovine Leukemia Virus 5'Long … - Full text - MIT Libraries
C Calomme, A Dekoninck, S Nizet, E Adam, TLA … - J Virol, 2004 - jvi.asm.org
... Gels were dried and autoradiographed for 24 to 48 h at –70°C. For supershift assays,
polyclonal antibodies against USF1 (sc-229), USF2 (sc-862), Max (sc-197 ...
Web Search - jvi.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
THE ROLE OF PU. 1 IN B-LYMPHOCYTE DEVELOPMENT AND FUNCTION
S RAO, MC SIMON - doi.wiley.com
... CD20 TTTCAAGAAGTGAAACCTGG Pip, USF1 Himmelmann et al., 1997 ... A second study used chicken
blastoderm cells transformed with a Myb-Ets-Gag E26leukemia virus to ...
Web Search
Analysis of Myc/Max/Mad network members in adipogenesis: Inhibition of the proliferative burst and … - Full text - MIT Libraries
B Pulverer, A Sommer, GA McArthur, RN Eisenman, B … - Journal of Cellular Physiology, 2000 - doi.wiley.com
... Hurlin et al., 1997). Anti-USF1 polyclonal serum was kindly provided by
M. Sawadogo (Timchenko et al., 1995). The antiserum 022Y ...
Cited by 22 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
The 2001 Veylien Henderson Award of the Society of Toxicology of Canada. Positive and negative …
DS Riddick, C Lee, A Bhathena, YE Timsit - Can. J. Physiol. Pharmacol, 2003 - article.pubs.nrc-cnrc.gc.ca
... of an ATPase containing chromatin-remodeling factor (Wang and Hankinson 2002), and
interactions of the AHR–ARNT com- plex with Myb-binding protein 1a (Jones ...
Cited by 1 - Web Search - article.pubs.nrc-cnrc.gc.ca - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Stat3 and Tumor Cell Proliferation
N Schick - unibas.ch
Page 1. Stat3 and Tumor Cell Proliferation Inauguraldissertation zur Erlangung
der Würde eines Doktors der Philosophie vorgelegt der ...
View as HTML - Web Search - pages.unibas.ch - unibas.ch - pages.unibas.ch
Current World Literature
S Abe Dohmae, Y Ikeda, M Matsuo… - Current Opinion in Lipidology, 2005 - co-lipidology.com
June 2005, 16:3 > Current World Literature. ...
Web Search
Did you mean to search for: US F1 and MYB
|
©2005 Google