![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 199 for YY1 and NF1. (0.08 seconds) |
YY1 and NF1 both activate the human p53 promoter by alternatively binding to a composite element, … - Full text - MIT Libraries
EE Furlong, T Rein, F Martin - Mol Cell Biol, 1996 - mcb.asm.org
... YY1 and NF1 Both Activate the Human p53 Promoter by ... 1B), suggesting a significant
role for both YY1 and NF1 in the regulation of p53 promoter function. ...
Cited by 37 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
In simple synthetic promoters YY 1-induced DNA bending is important in transcription activation and … - Full text - MIT Libraries
J Kim, DJ Shapiro - Nucleic Acids Research, 1996 - nar.oupjournals.org
... RESULTS. COS cell nuclear extracts contain proteins which bind to the YY1, NF1
and AP1 sites. ... YY1 potentiates transcription activation by NF1. ...
Cited by 23 - Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Context-dependent Transcriptional Regulation - Full text - MIT Libraries
CJ Fry, PJ Farnham - J Biol Chem, 1999 - dx.doi.org
... stimulate promoter activity if placed between a binding site for nuclear factor
1 (NF1) and a TATA box but not if the positions of the YY1 and NF1 sites are ...
Cited by 76 - Web Search - jbc.org - ncbi.nlm.nih.gov
A 40-kDa NF1-like protein, not YY1, binds to the rat p53 promoter for transactivation in various rat … - Full text - MIT Libraries
M Lee, H Song, S Yu, K Lee, JS Park - Biochem Cell Biol, 1999 - article.pubs.nrc-cnrc.gc.ca
... NF1, YY1, and CRE oligonucleotides were used as competitors. ... YY1 and NF1 both
acti- vate the human p53 promoter by alternatively binding to a ...
Cited by 6 - Web Search - article.pubs.nrc-cnrc.gc.ca - ncbi.nlm.nih.gov
Biochemical characterization of a nuclear factor that binds to NF 1-like elements in the rat p 53 … - Full text - MIT Libraries
M Lee, S Yu, J Park - Journal of Cellular Biochemistry, 2000 - doi.wiley.com
... protease treatment (Fig. 6C,D). The oligonucleotides containing YY1, NF1, or
CRE consensus motifs were used as competitors. Figure 6C,D ...
Cited by 5 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Differential binding of NF1 transcription factor to P53 gene promoter and its depletion in human …
BK Nayak, BR Das - Molecular Biology Reports, 1999 - springerlink.com
... Recently, a tissue specific binding of NF1/YY1 to p53 promoter has been reported
and further, it has been demonstrated that NF1/YY1 activates p53 ...
Cited by 5 - Web Search - kluweronline.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Transcription of the rat p53 gene is mediated by factor binding to two recognition motifs of NF1- …
M Lee, H Song, S Park, JS Park - Biol Chem, 1998 - ncbi.nlm.nih.gov
... To identify the protein binding to these elements, competition assays were carried
out with double stranded oligonucleotides containing NF1, YY1, and CRE ...
Cited by 13 - Web Search - Get it from MIT Libraries
Identification of a transcription factor, an 80-kDa protein that interacts with the HLH recognition … - Full text - MIT Libraries
H Song, M Lee, S Yu, J Park - Biochem Cell Biol, 2001 - article.pubs.nrc-cnrc.gc.ca
... YY1 and NF1 both acti- vate the human p53 promoter by alternatively binding to a
com- posite element, and YY1 and E1A cooperate to amplify p53 promoter ...
Cited by 2 - Web Search - article.pubs.nrc-cnrc.gc.ca - ingentaconnect.com - ncbi.nlm.nih.gov
Characterization of a nuclear factor that binds to AP 1-like element in the rat p 53 promoter during … - Full text - MIT Libraries
M Lee, S Yu, J Park - Journal of Cellular Biochemistry, 2001 - doi.wiley.com
... YY1 and NF1 both activate the human p53 promoter by alternatively bind- ing to a
composite element, and YY1 and E1A cooperate to amplify p53 promoter activity. ...
Cited by 3 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Characterization of nuclear factors binding to AT-rich element in the rat p 53 promoter - Full text - MIT Libraries
M Lee, S Yu, Y Lee, J Park - Journal of Cellular Biochemistry, 2001 - doi.wiley.com
... YY1 and NF1 both activate the human p53 promoter by alternatively binding to a
composite element, and YY1 and E1A coope- rate to amplify p53 promoter activity. ...
Cited by 2 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Mutation and Methylation Status of p 53 Gene Promoter in Human Breast Tumours - Full text - MIT Libraries
BK Nayak, BR Das, BR Das, F Alert - Tumor Biology, 1999 - content.karger.com
... External Resources 13 Furlong EM, Rain T, Martin F: YY1 and NF1 both activate the
human p53 promoter alternatively binding to a composite element, and YY1 and ...
Cited by 1 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 6 versions »
NF-kappaB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene enhancer/ … - Full text - MIT Libraries
Y Lee, WJ Sohn, DS Kim, HJ Kwon - European Journal of Biochemistry, 2004 - content.febsjournal.org
... region. These elements contain consensus binding sites for transcription
factors such as NF- B/Rel, ATF/CREB, YY1 and NF1 [7–13]. ...
Cited by 2 - Cached - Web Search - blackwell-synergy.com - ejbiochem.org - ncbi.nlm.nih.gov - all 5 versions »
Analysis of mutations in the URR and E 6/E 7 oncogenes of HPV 16 cervical cancer isolates from … - Full text - MIT Libraries
AL Stephen, CH Thompson, MH Tattersall, YE Cossart … - International Journal of Cancer, 2000 - doi.wiley.com
... deletion of 436 bases in the enhancer; while varying combinations of 21 point mutations
were iden- tified in the remainder, impacting several YY1, NF1, TEF-1 ...
Cited by 8 - Web Search - doi.wiley.com - milkpa.idv.tw - ncbi.nlm.nih.gov
Biochemistry and Cell Biology
M Lee, S Kim, G Kim, M Lee, J Park - pubs.nrc-cnrc.gc.ca
... 1) and the other between -195 and -219 (NF1-like element 2). The latter one was
also identified as a NF1/YY1 recognition motif in the human p53 promoter. ...
Cached - Web Search - pubs.nrc-cnrc.gc.ca
Context-dependent Transcriptional Regulation
TACB Achieved - cbr.med.harvard.edu
... stimulate promoter activity if placed between a binding site for nuclear factor
1 (NF1) and a TATA box but not if the positions of the YY1 and NF1 sites are ...
View as HTML - Web Search - genomecenter.ucdavis.edu - mcardle.oncology.wisc.edu - genomics.ucdavis.edu - all 6 versions »
Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural … - Full text - MIT Libraries
RL FERRIS, I MARTINEZ, N SIRIANNI, J Wang, A Lopez … - Eur. J. Cancer, 2005 - ncbi.nlm.nih.gov
... UPCI:SCC090 revealed a deletion of 163 bp, removing a portion of the enhancer sequence,
including the binding sites for the transcription factors YY1 and NF1. ...
Cited by 1 - Web Search
NF-jB-and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene enhancer/promoter …
Y Lee, WJ Sohn, DS Kim, HJ Kwon - ingentaconnect.com
... region. These elements contain consensus binding sites for transcription
factors such as NF-jB/Rel, ATF/CREB, YY1 and NF1 [7–13]. ...
Web Search
Involvement of YY1 and its correlation with c-myc in NDEA induced hepatocarcinogenesis, its …
T Parija, BR Das - Molecular Biology Reports, 2003 - kluweronline.com
... Pre-incubation with a 100-fold excess of cold YY1 oligonucleotide completely reduced
the YY1 complex and 100 fold excess cold NF1 nucleotide put no effect on ...
Cited by 1 - Web Search - springerlink.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Chromosome 11 Loss from Thymic Lymphomas Induced in Heterozygous Trp 53 Mice by Phenolphthalein - Full text - MIT Libraries
JE Hulla, JE French, JK Dunnick - Toxicological Sciences, 2001 - toxsci.oupjournals.org
... YY1 and NF1 both activate the human p53 promoter by alternatively binding to a
composite element, and YY1 and E1A cooperate to amplify p53 promoter activity. ...
Cited by 3 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - csa.com - all 8 versions »
YY1 and its repressive effect on human papillomavirus 16 early promoter P97 existed widely among …
X Dong, H Liu, H Pfister - Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 1998 - ncbi.nlm.nih.gov
... It suggests that YY1 regulatory system exists widely in human epithelial cell lines.
We also found that the transcription activator NF1 was more highly ...
Web Search - Get it from MIT Libraries
NFI-Ski interactions mediate transforming growth factor beta modulation of human papillomavirus type … - Full text - MIT Libraries
A Baldwin, L Pirisi, KE Creek - J Virol, 2004 - pubmedcentral.nih.gov
... None of the YY1 mutant reporter constructs or the YY1-NF1 combination mutant reporter
constructs exhibited a loss of TGF-β inhibition, suggesting that the YY1 ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Rolle des zellulaeren Transkriptionsfaktors YY1 bei der Kontrolle der Replikation und Transkription …
M Adam - ub.uni-koeln.de
... Sequenzelemente; AP1: Bindestelle für den zellulären Transkriptionsfaktor AP1; NF1:
Bindestellen für den zellulären Traskriptionsfaktor NF1; YY1-BS0-3 ...
View as HTML - Web Search - deposit.ddb.de
Overlapping YY1-and aberrant SP1-binding sites proximal to the early promoter of human … - Full text - MIT Libraries
XP Dong, H Pfister - Journal of General Virology, 1999 - vir.sgmjournals.org
... AP1 (Chan et al., 1990 ), NF1 (Apt et al., 1993 ), Oct1 (O'Connor & Bernard, 1995 ),
SP1 (Gloss & Bernard, 1990 ), TEF1 (Ishiji et al., 1992 ), YY1 (May et al ...
Cited by 7 - Web Search - jgv.sgmjournals.org - jgv.sgmjournals.org - ncbi.nlm.nih.gov - all 6 versions »
Mutation and Methylation Status of p53 Gene Promoter in Human Breast Tumours - Full text - MIT Libraries
BKNBR Das - Tumor Biol, 1999 - content.karger.com
... 13 Furlong EM, Rain T, Martin F: YY1 and NF1 both activate the human p53 promoter
alternatively binding to a composite element, and YY1 and E1A cooperate to ...
Web Search - content.karger.com
YY1 is a positive regulator of transcription of the Col1a1 gene - Full text - MIT Libraries
FB Riquet, L Tan, BK Choy, M Osaki, G Karsenty, TF … - J. Biol. Chem, 2001 - intl.jbc.org
... However, YY1-induced DNA bending via the YY1A site could bring factors, such as
NF1, that are bound to upstream sites into close proximity to proteins bound to ...
Cited by 10 - Web Search - jbc.org - intl.jbc.org - ncbi.nlm.nih.gov - all 5 versions »
Positive and negative regulatory elements in the upstream region of the rat Cu/Zn-superoxide … - Full text - MIT Libraries
MS Chang, HY Yoo, HM Rho - Biochem. J, 1999 - biochemj.org
... site in the NRE, we analysed the DNA sequence from k412 to k305 and found four possible
putative transcription-factor-binding sites (for YY1, NF1, MyoD and AP1 ...
Cited by 7 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The gene encoding the transcriptional regulator Yin Yang 1 (YY1) is a myeloid transforming gene … - Full text - MIT Libraries
SJ Erkeland, M Valkhof, C Heijmans-Antonissen, R … - Blood, 2003 - bloodjournal.org
... 1, Nf1, p53, Fli-1, Evi-1) and in several novel loci (SJE et al, manuscript in
preparation). One of these newly identified integrations occurred in the YY1 ...
Cited by 9 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Cloning and Characterization of the 5'-Flanking Region for the Human Topoisomerase III Gene - Full text - MIT Libraries
JC Kim, JB Yoon, HS Koo, IK Chung - J Biol Chem, 1998 - jbc.org
... et al.(47) demonstrated that YY1 functions as an activator to increase human p53
promoter activity in a composite element that can bind both YY1 and NF1 in a ...
Cited by 12 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
E 2 F-mediated Growth Regulation Requires Transcription Factor Cooperation - Full text - MIT Libraries
PR van Ginkel, KM Hsiao, H Schjerven, PJ Farnham - J Biol Chem, 1997 - jbc.org
... Oligonucleotides containing consensus CCAAT, YY1, p53, NF1, Oct1, Sp1, and AP2 sites
as well as a GC element from the Rep3A promoter were cloned immediately ...
Cited by 27 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
NF 1/X represses PDGF A-chain transcription by interacting with Sp 1 and antagonizing Sp 1 occupancy … - Full text - MIT Libraries
LA Rafty, FS Santiago, LM Khachigian - The EMBO Journal, 2002 - embojournal.npgjournals.com
... Furlong,EEM, Rein,T. and Martin,T. (1996) YY1 and NF1 both activate the human p53
promoter by alternatively binding to a composite element and YY1 and E1A ...
Cited by 7 - Web Search - nature.com - emboj.org - pubmedcentral.nih.gov - all 6 versions »
Increased Induction of Osteopetrosis, but Unaltered Lymphomagenicity, by Murine Leukemia Virus SL3-3 … - Full text - MIT Libraries
S Ethelberg, BD Tzschaschel, A Luz, SJ Diaz-Cano, … - J. Virol, 1999 - jvi.asm.org
... YY1 and NF1 both activate the human p53 promoter by alternatively binding to a
composite element, and YY1 and E1A cooperate to amplify p53 promoter activity. ...
Cited by 2 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Endogenous retroviruses and human evolution
K Khodosevich, Y Lebedev, E Sverdlov - studies - doi.wiley.com
... AATAAA Polyadenylation signal Promoter Enhancer core 5′ 3′ TBF HRE C/EBP CBF/NF1
CBF/NF1 YY1 CCAAT 75 bp NFκB U5 R U3 TATAA Structural scheme of LTR A B ...
Web Search - ingentaconnect.com - salonin.ru
Identification of transcription factor in the promoter region of rat regucalcin gene: Binding of … - Full text - MIT Libraries
H Misawa, M Yamaguchi - Journal of Cellular Biochemistry, 2002 - doi.wiley.com
... YY1 and NF1 both activate the human p53 promoter by alternatively binding to a
composite element, and YY1 and E1A cooperate to amplify p53 promoter activity. ...
Cited by 15 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Regulation of human papillomavirus type 16 DNA replication by E2, glucocorticoid hormone and … - Full text - MIT Libraries
A Piccini, A Storey, M Romanos, L Banks - J. Gen. Virol, 1997 - vir.sgmjournals.org
... and EGF upon viral DNA replication The URR contains many potential binding sites
for cellular transcription factors including Sp1, AP-1, YY1 and NF1 (Gloss & ...
Cited by 5 - Web Search - jgv.sgmjournals.org - vir.sgmjournals.org - ncbi.nlm.nih.gov
Nucleoprotein structure of immediate-early promoters Zp and Rp and of oriLyt of latent Epstein-Barr … - Full text - MIT Libraries
HH Niller, D Salamon, J Uhlig, S Ranf, M Granz, F … - J Virol, 2002 - jvi.asm.org
... The shift experiments demonstrated that the four binding sites, YY1, Sp1, NF1, and
HI, contributed to specific in vitro protein binding at this locus (data not ...
Cited by 3 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Transcriptional regulation of the hamster Muc1 gene: identification of a putative negative … - Full text - MIT Libraries
IJ Lee, SW Hyun, A Nandi, KC Kim - Am J Physiol Lung Cell Mol Physiol, 2003 - ajplung.physiology.org
... YY1 and NF1 both activate the human p53 promoter by alternatively binding to a
composite element, and YY1 and E1A cooperate to amplify p53 promoter activity. ...
Cited by 4 - Web Search - ajplung.physiology.org - ncbi.nlm.nih.gov
21201, USA
KC Kim - ajplung.physiology.org
... Am. J. Physiol. 270: L846-L853, 1996. 17. Furlong EM, Rein T, and Martin
F. YY1 and NF1 both activate the human p53 promoter by ...
Web Search
Evidence of a role for phosphatidylinositol 3-kinase activation in the blocking of apoptosis by … - Full text - MIT Libraries
J Dahl, A Jurczak, LA Cheng, DC Baker, TL Benjamin - J. Virol, 1998 - jvi.asm.org
... YY1 and NF1 both activate the human p53 promoter by alternatively binding to a
composite element, and YY1 and E1A cooperate to amplify p53 promoter activity. ...
Cited by 32 - Web Search - jvi.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Cdx Binding Determines the Timing of Enhancer Activation in Postnatal Duodenum - Full text - MIT Libraries
EA Maier, MR Dusing, DA Wiginton - J Biol Chem, 2005 - jbc.org
... View this table: [in this window] [in a new window], TABLE II Duodenal CAT activities
of wt, Cdx mutant, YY1 mutant, and NF1 mutant transgenic mice CAT ...
Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
Partial purification and characterization of an 80-kDa transcription factor binding to bHLH motif in …
M Lee, Y Lim, J Park - Molecular Biology Reports, 2002 - kluweronline.com
... For instance, in the human p53 promoter, NF1 or YY1 binds to the NF1 recognition
site and regulates the ex- pression of the p53 gene in a tissue-specific manner ...
Web Search - springerlink.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Mechanisms of Cr (VI)-induced p 53 activation: the role of phosphorylation, mdm 2 and ERK - Full text - MIT Libraries
S Wang, X Shi - Carcinogenesis, 2001 - carcin.oupjournals.org
... J. Biol. Chem., 269, 25728–25734. [Abstract/Free Full Text]; Furlong,EEM, Rein,T.
and Martin,F. (1996) YY1 and NF1 both activate the human p53 promoter by ...
Cited by 23 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - csa.com - all 6 versions »
Multispecies Comparison of the Casein Gene Loci and Evolution of Casein Gene Family
M Rijnkels - Journal of Mammary Gland Biology and Neoplasia, 2002 - springerlink.com
Page 1. Journal of Mammary Gland Biology and Neoplasia, Vol. 7, No. 3, July
2002 ( C 2002) Multispecies Comparison of the Casein Gene Loci ...
Cited by 4 - Web Search - kluweronline.com - ingentaconnect.com - bcm.edu - all 7 versions »
Structure and genomic organization of porcine RACK1 gene
YC Chou, CC Chou, YK Chen, S Tsai, FM Hsieh, HJ … - Biochim Biophys Acta, 1999 - apple.sysbio.info
... an AP1 binding site, an SP1 binding site, a c-myb binding site, a c-myc binding
site, a serum response element (SRE), a YY1 binding site, a NF1 binding site ...
Cited by 6 - View as HTML - Web Search - rayl0.bio.uci.edu - ingentaconnect.com - all 4 versions »
Two YY-1-binding Proximal Elements Regulate the Promoter Strength of the TATA-less Mouse … - Full text - MIT Libraries
E Johansson, K Hjortsberg, L Thelander - J Biol Chem, 1998 - jbc.org
... It has been shown that NF1 and YY1 both can activate the human p53 promoter
by alternative binding to a composite element (26). ...
Cited by 15 - Web Search - medchem.umu.se - jbc.org - ncbi.nlm.nih.gov
Estrogen up-regulation of p53 gene expression in MCF-7 breast cancer cells is mediated by calmodulin … - Full text - MIT Libraries
C Qin, T Nguyen, J Stewart, I Samudio, R Burghardt … - Mol Endocrinol, 2002 - mend.endojournals.org
... indicated that the -106 to +12 region (p53-6) is required for E2 responsiveness,
and this sequence contains putative binding sites for CTF-1/YY1, nuclear factor ...
Cited by 10 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
NE Gyulikhandanova, NV Tsymbalenko,
NA Platonova, VS Babich, LV Puchkova - Bulletin of Experimental Biology and Medicine, 2004 - kluweronline.com
... fold excess of unlabeled YY1. 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 ... 13 gacTGGCatcagagcagg
NF1 Nuclear factor 1 1103 14 gaATGTa OCT1 Octamer binding factor 1 1114 ...
Web Search - springerlink.com
Exon structure of the nuclear factor I DNA-binding domain from C. elegans to mammals - Full text - MIT Libraries
CF Fletcher, NA Jenkins, NG Copeland, AZ Chaudhry, … - Mamm Genome, 1999 - springerlink.com
... Genomics 45, 313–319 Furlong EE, Rein T, Martin F (1996) YY1 and NF1 both activate
the human p53 promoter by alternatively binding to a composite element ...
Cited by 11 - Web Search - elegans.swmed.edu - ncbi.nlm.nih.gov
Transcriptional regulation of the rat type IIA phospholipase A 2 gene by cAMP and interleukin-1β in … - Full text - MIT Libraries
M RAYMONDJEAN - Biochem. J, 2002 - biochemj.org
... NF-κB GGGACAGAGGGGACTTTCCGAGAGG NF1 GGATGGCCACGTGCGCCAAGGCG NFY
GGGGTAGGAACCAATGAAATGAAACGTTA Sp1 AGCTTCCGTTGGGGCGGGGCTTCACGTCC YY1 ...
Cited by 5 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
The bovine papillomavirus type 4 long control region contains an epithelial specific enhancer
IM Morgan, GJ Grindlay, MS Campo - Journal of General Virology80, 1999 - vir.sgmjournals.org
... et al., 1993), NF1 (Apt et al., 1993, 1994; O’Connor & Bernard, 1995), PEF-1 (Cuthill
et al., 1993; Sibbet et al., 1995), Sp1 (Apt et al., 1996) and YY1 (O ...
Cited by 3 - Web Search - jgv.sgmjournals.org - vir.sgmjournals.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
The RACK1 scaffold protein: a dynamic cog in cell response mechanisms - Full text - MIT Libraries
A McCahill, J Warwicker, GB Bolger, MD Houslay, SJ … - Mol Pharmacol, 2002 - dx.doi.org
... The RACK1 gene promoter contains a number of transcription factor binding sites
including serum response element, AP1, SP1, NF1, and YY1 (Chou et al., 1999 ). ...
Cited by 23 - Web Search - molpharm.aspetjournals.org - ncbi.nlm.nih.gov
|
©2005 Google