![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 101 for YY1 and SRY. (0.21 seconds) |
DNA bending and orientation-dependent function of YY1 in the c-fos promoter
S Natesan, MZ Gilman - Genes Dev, 1993 - genesdev.org
... Thus, YY1 represents a new class of transcription factors that influences promoter
function by ... that the product of the male sex determination gene SRY may also ...
Cited by 106 - Web Search - genesdev.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Members of the SRY family regulate the human LINE retrotransposons - Full text - MIT Libraries
T Tchenio, JF Casella, T Heidmann - Nucleic Acids Research, 2000 - nar.oupjournals.org
... fact, it has been proposed that the mode of action of the SRY factor and ... in the promoter
sequence, except those previously characterised for the YY1 protein (29 ...
Cited by 16 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Expression of Sry, the mouse sex determining gene - Full text - MIT Libraries
A Hacker, B Capel, P Goodfellow, R Lovell-Badge - Development, 1995 - dev.biologists.org
... Testis determination in mammals occurs in the gonadal anlage due to the action of
the Y-linked gene Sry. ... Expression of Sry, the mouse sex determining gene ...
Cited by 154 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Expression of the human endogenous retrovirus HTDV/HERV-K is enhanced by cellular transcription … - Full text - MIT Libraries
M Knossl, R Lower, J Lower - J. Virol, 1999 - jvi.asm.org
... The YY1 binding site between bp 62 and 83 overlaps with highly conserved
consensus binding sites for C/EBP and SRY. Binding of these ...
Cited by 14 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Binding of YY1 to a site overlapping a weak TATA box is essential for transcription from the … - Full text - MIT Libraries
J Klug, M Beato - Mol Cell Biol, 1996 - mcb.asm.org
... Binding of YY1 to a Site Overlapping a Weak TATA Box Is Essential for Transcription
from the Uteroglobin ... 16, 1996 YY1 BINDING SITE OVERLAPPING WEAK TATA BOX ...
Cited by 9 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
The Nuclear Matrix Protein NMP-1 is the Transcription Factor YY1 - Full text - MIT Libraries
J SOLWAY, SM FORSYTHE, AJ HALAYKO, JE VIEIRA, MB … - Proceedings of the National Academy of Sciences - pnas.org
... T. Tchénio, JF Casella, and T. Heidmann Members of the SRY family regulate ... M. Claustres
A Naturally Occurring Sequence Variation That Creates a YY1 Element Is ...
Web Search
Trans-activation and DNA-binding properties of the transcription factor, Sox-18 - Full text - MIT Libraries
BM Hosking, GEO Muscat, PA Koopman, DH Dowhan, TL … - Nucleic Acids Res, 1995 - pubmedcentral.nih.gov
... Kun J, Evans T, Gangadharan U, Greenfield A, Koopman P. The Sry-related gene ... for
physical interaction between the zinc-finger transcription factors YY1 and Sp1 ...
Cited by 27 - Web Search - nar.oupjournals.org - ncbi.nlm.nih.gov
Regulation of human SRY subcellular distribution by its acetylation/deacetylation - Full text - MIT Libraries
L Thevenet, C Mejean, B Moniot, N Bonneaud, N … - The EMBO Journal, 2004 - nature.com
Regulation of human SRY subcellular distribution by its acetylation/deacetylation ...
We also identified that HDAC3 asso- ciated with and then deacetylated SRY. ...
Cited by 3 - Web Search - pubmedcentral.nih.gov - embojournal.npgjournals.com - ncbi.nlm.nih.gov - all 5 versions »
In simple synthetic promoters YY 1-induced DNA bending is important in transcription activation and … - Full text - MIT Libraries
J Kim, DJ Shapiro - Nucleic Acids Research, 1996 - nar.oupjournals.org
... architectural' transcription regulators are LEF1 ( 27 , 28 ), HMG I/Y ( 29 ), SRY (
30 , 31 ) and UBF ( 32 ). Some regulatory proteins, such as YY1, may have ...
Cited by 23 - Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Untitled
dx.doi.org
... de Wetering, M., Oosterwegel, M., van Norren, K. & Clevers, H. Sox-4, an Sry-like
HMG ... PubMed | ISI | ChemPort |; Ericsson, J., Usheva, A. & Edwards, PA YY1 is a ...
Cited by 83 - nature.com - nature.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... 22.0 CREL GABP 276.3 IRF1 SRY 81.9 CREB USF 35.0 TATA YY1 21.6 CREBP1 CREBP1
265.6 RORA2 TCF11 80.9 GR HNF4 34.9 AHRARNT ATF 21.6 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
A YY 1-binding site is required for accurate human LINE-1 transcription initiation - Full text - MIT Libraries
JN Athanikar, RM Badge, JV Moran - Nucleic Acids Research, 2004 - nar.oupjournals.org
... Besides the YY1-binding site, two putative SRY-related transcription factor binding
sites, a putative RUNX3 transcription factor binding site, as well as an ...
Cited by 4 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
The DNA-binding specificity of SOX 9 and other SOX proteins - Full text - MIT Libraries
S Mertin, SG McDowall, VR Harley - Nucleic Acids Research, 1999 - nar.oupjournals.org
... prime] G following the SCBE, while this Ala is substituted with Ser in SRY and Sox5 ...
SP1 and YY1 are two examples where their in vitro selected DNA-binding sites ...
Cited by 50 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
Methyl-CpG-binding protein 2 represses LINE-1 expression and retrotransposition but not Alu … - Full text - MIT Libraries
F Yu, N Zingler, G Schumann, WH Stratling - Nucleic Acids Research, 2001 - nar.oupjournals.org
... In contrast to two known positive regulatory factors of L1 transcription, the
ubiquitous factor YY1 and a neuronally expressed SRY family transcription factor ...
Cited by 13 - Web Search - pubmedcentral.nih.gov - nar.oxfordjournals.org - ingentaconnect.com - all 7 versions »
SOX 7 and SOX 17 Regulate the Parietal Endoderm-specific Enhancer Activity of Mouse Laminin{alpha} 1 … - Full text - MIT Libraries
T Niimi, Y Hayashi, S Futaki, K Sekiguchi - J Biol Chem, 2004 - jbc.org
... Because Sp1/Sp3 and YY1 are ubiquitous transcription factors, other factor(s) that ...
similar to that found in the mammalian testis-determining factor SRY (21-23 ...
Cited by 1 - Web Search - jbc.org - ncbi.nlm.nih.gov
Identification and characterization of the human XIST gene promoter: implications for models of X … - Full text - MIT Libraries
B Hendrich, RM Plenge, HF Willard - Nucleic Acids Research, 1997 - nar.oupjournals.org
... sc-421; polyclonal anti-YY1, no. ... see above); transgene G6H6, primers G6
(TACTCTTCCACTCACTTTTC) and H6 (AGAGAGTGCAACAACCCACA)] and primers for the Sry gene ...
Cited by 23 - Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Assessment of promoter elements of the germ cell-specific proacrosin gene - Full text - MIT Libraries
HJ Schulten, K Nayernia, K Reim, W Engel, P … - Journal of Cellular Biochemistry, 2001 - doi.wiley.com
... is known as the conserved core binding motif for Sox (Sry-related HMG ... Alignment analysis
revealed the presence of putative YY1 binding sites in the promoters ...
Cited by 3 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
A novel computational approach for the prediction of networked transcription factors of Ah-receptor … - Full text - MIT Libraries
A Kel, S Reymann, V Matys, P Nettesheim, E … - Molecular Pharmacology, 2004 - molpharm.aspetjournals.org
... of promoters of AhR regulated genes (-2000/+2000) are listed. One matrix
(YY1) and two pairs (E2F/ROR and AhR/CREB) were selected ...
Cited by 3 - Web Search - molpharm.org - molpharm.aspetjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Intrinsically bent DNA in a eukaryotic transcription factor recognition sequence potentiates … - Full text - MIT Libraries
J Kim, S Klooster, DJ Shapiro - J Biol Chem, 1995 - jbc.org
... transcription regulatory proteins such as HMGI/Y(17) , the lymphocyte enhancer factor
(LEF-1)(18) , YY1(19) , and the mammalian sex determining factor SRY(18 ...
Cited by 22 - Web Search - jbc.org - ncbi.nlm.nih.gov
Cooperative Transcriptional Activation by Serum Response Factor and the High Mobility Group Protein … - Full text - MIT Libraries
JA Spencer, MH Baron, EN Olson - J Biol Chem, 1999 - jbc.org
... transcription factors that influence SRF activity are Ying Yang 1 (YY1) (14), the ...
enhancer-binding factor, LEF-1, the sex-determining factor, SRY, the related ...
Cited by 17 - Web Search - jbc.org - ncbi.nlm.nih.gov
Human Muellerian inhibiting substance promoter contains a functional TFII-I-binding initiator - Full text - MIT Libraries
N Morikawa, TR Clarke, CD Novina, K Watanabe, C … - Biol Reprod, 2000 - bioone.org
... by initiator-specific binding proteins such as TFII-I [36, 37] or YY1 [30] , which
can ... for the human sex-determining region of the Y chromosome (SRY) was made ...
Cited by 8 - Web Search - biolreprod.org - mgh.harvard.edu - ncbi.nlm.nih.gov - all 6 versions »
The genomic structure of two protein kinase CK2alpha genes of Xenopus laevis and features of the …
V Wilhelm, G Neckelman, JE Allende, CC Allende - Molecular and Cellular Biochemistry, 2001 - kluweronline.com
... that match those of transcription fac- tor binding sites, including, besides those
indicated in the figure 7A, sites for factors YY1 (–85), SRY (–103, –97 ...
Cited by 2 - Web Search - springerlink.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Mobile elements and mammalian genome evolution
PL Deininger, JV Moran, MA Batzer, HH Kazazian - Curr. Opin. Genet. Dev, 2003 - batzerlab.lsu.edu
... promoter functions requires additional study; however, cis-acting sequences important
for transcription include a YY1-binding site [11], SRY family binding ...
Cited by 20 - View as HTML - Web Search - uta.edu - mcb.berkeley.edu - anthro.utah.edu - all 9 versions »
Prospect of single flux quantum logic in superconducting digital electronics
K J H, JX Przybysz, DL Miller, DL Meler, MG … - Supercond. Sci. Technol - iop.org
... ine iaci mar sry iogc uses overaampea junciions makes this logic useful in developing
high-T, supercon- ducting digital electronics. ... '"'L'6C yY1"L' 6 C " CL ...
Web Search
Mammalian chromodomain proteins: their role in genome organisation and expression - Full text - MIT Libraries
DO Jones, IG Cowell, PB Singh - BioEssays, 2000 - doi.wiley.com
... toma binding protein 1; RYBP, Ring1 and YY1 binding protein; SET, Suvar-E(z)-trithorax;
SP100, primary biliary cirrhosis autoantigen; Sry, sex-determining ...
Cited by 100 - Web Search - doi.wiley.com - snhs-plin.barry.edu - ncbi.nlm.nih.gov - all 5 versions »
The Lacrimal Gland Transcriptome Is an Unusually Rich Source of Rare and Poorly Characterized Gene … - Full text - MIT Libraries
AM Ozyildirim, GJ Wistow, J Gao, J Wang, DP … - Investigative Ophthalmology & Visual Science, 2005 - iovs.org
... 3–5 gene pairs) of putative TFAP2A (AP-2 ), ELK1, FOXF2, FOXF1, FOXC1, FOXL1, SRY,
HAND1, and YY1 sites and a few others (2 or fewer gene pairs). ...
Web Search - dx.doi.org - iovs.org - ncbi.nlm.nih.gov
EUKARYOTIC TRANSCRIPTION FACTOR-DNA COMPLEXES - Full text - MIT Libraries
G Patikoglou, SK Burley - Annual Review of Biophysics and Biomolecular Structure, 1997 - biophys.annualreviews.org
... Like TBP, both SRY and LEF-1 make additional side chain-minor groove base edge
interactions that are primarily hydrophobic ... YY1: Initiator Element Recognition. ...
Cited by 50 - Web Search - biophys.annualreviews.org - plant.annualreviews.org - ncbi.nlm.nih.gov
Microarray analysis of gene expression in human donor sclera - Full text - MIT Libraries
TL Young, GS Scavello, PC Paluru, JD Choi, EF … - Mol Vis, 2004 - molvis.org
Page 1. Molecular Vision 2004; 10:163-76 <http://www.molvis.org/molvis/v10/a22>
Received 3 October 2003 | Accepted 16 March 2004 | Published 22 March 2004 ...
Cited by 3 - View as HTML - Web Search - molvis.org - scavello.net - ncbi.nlm.nih.gov
Transcriptional regulation of the human LINE-1 retrotransposon L 1. 2 B - Full text - MIT Libraries
C Steinhoff, WA Schulz - Molecular Genetics and Genomics, 2004 - springerlink.com
... types of transcription factors have been proposed as important, ie YY1, which binds ...
LINE-SRYdel was obtained by mutation of the SRY binding site at positions ...
Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
A compilation of composite regulatory elements affecting gene transcription in vertebrates - Full text - MIT Libraries
OV Kel, AG Romaschenko, AE Kel, E Wingender, NA … - Nucleic Acids Res, 1995 - pubmedcentral.nih.gov
... Y. Evidence for physical interaction between the zinc-finger transcription factors
YY1 and Sp1 ... M, Oosterwegel M, van Norren K, Clevers H. Sox-4, an Sry-like HMG ...
Cited by 61 - Web Search - nar.oupjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
TRANSFAC (R): transcriptional regulation, from patterns to profiles - Full text - MIT Libraries
V Matys, E Fricke, R Geffers, E Gossling, M … - Nucleic Acids Research, 2003 - nar.oupjournals.org
... factors c-Jun, c-Fos, c-Myc, c-Myb, E2F1, CRE-BP1, C/EBP- , RAR-ß, RAR- , SRY. ... GR,
NF- B, STAT, AP-1, CREB) and constitutive (Sp1, TBP, NF-1, YY1, USF), are ...
Cited by 201 - Web Search - pubmedcentral.nih.gov - informatik.uni-leipzig.de - csb.yale.edu - all 13 versions »
1. 9 Aa resolution refined structure of TBP recognizing the minor groove of TATAAAAG - Full text - MIT Libraries
JL Kim, SK Burley - Nature Structural Biology, 1994 - nature.com
... | PubMed | ISI | ChemPort |; King, CY & Weiss, MA The SRY high-mobility ... Usheva, A.
& Shenk, T. TATA-binding protein-independent initiation: YY1, TFIIB, and RNA ...
Cited by 70 - Web Search
Induction of the Human Papillomavirus Type 31 Late Promoter Requires Differentiation but Not DNA … - Full text - MIT Libraries
KM Spink, LA Laimins - J Virol, 2005 - jvi.asm.org
... of factors, including AP1, C/EBPß, NF1, Oct1, Sp1, TEF-2, and YY1 (1, 2 ... potential
transcription factor binding sites for Oct-1, SOX5, and SRY were identified ...
Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Phylogenetic analysis of Hoxa 11 sequences reveals absence of transposable elements, conservation of …
DM Bodenmiller, CS Baxter, DV Hansen, SS POTTER - DNA Sequence, 2002 - dx.doi.org
... Human Chick %Homology‡ 2499–2706 5709–5914 90 MZF-1, TATA, CdxA (2), AML-1a
HNF-3b, Nkx-2, S8, Sp1, SRY (2) YY1 CP2 3120–3135 6147–6162 81 HSF1, HSF2 ...
Cited by 1 - Web Search - taylorandfrancis.metapress.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Deciphering transcriptional regulation relevant to eating behavior
DM Graunke, G Argyropoulos - Current Genomics, 2003 - ingentaconnect.com
... EFI √ YY1 √ Adf1 √ ... hAgRP (−1320/−1306) 5'-TTGCTTCATTTCATT-3' hNPY AP-1,C/EBPγ,
SRY hAgRP (−19,894/−19,880) 5'-ACACAAGAACAAACC-3' hNPY LEF-1 ...
Cited by 2 - Web Search
Primary structures and gene organizations of two types of Wap 65 from the pufferfish Takifugu …
M Hirayama, M Nakaniwa, D Ikeda, N Hirazawa, T … - Fish Physiology and Biochemistry, 2003 - springerlink.com
... 405, −58), C/EBPβ (−405), Ik-2 (−366), LyF-1 (−364), AML- 1a (−333), SRY
(−322, −170, −100, −72), Nkx-2.5 (−253) and YY1 (−145) were in ...
Web Search - kluweronline.com
The human L1 promoter: Variable transcription initiation sites and a major impact of upstream … - Full text - MIT Libraries
L Lavie, E Maldener, B Brouha, EU Meese, J Mayer - Genome Research, 2004 - genome.org
... Because YY1 is ubiquitously expressed, it cannot be solely responsible for the ...
Transcription factors belonging to the SRY family bind to two central regions ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... in lymphoid B-cells S8 01 S8 SOX9 B1 SOX (SRY-related HMG box) SRY 02 Sex ... Upstream
stimulating factor VMAF 01 v-Maf XBP1 01 X-box-binding protein 1 YY1 01 Yin ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Counting Boundary Paths for Oriented Percolation Clusters - Full text - MIT Libraries
P Balister, B Bollobas, A Stacey - Random Structures and Algorithms, 1999 - doi.wiley.com
Page 1. < < Counting Boundary Paths for Oriented Percolation Clusters Paul
Balister, 1 Bela Bollobas, 1 Alan Stacey 2 1 Department ...
Web Search - doi.wiley.com - portal.acm.org - emis.de
Hedgehog’s escape from Pandora’s box - Full text - MIT Libraries
BCC Abbreviations - J Mol Med, 1998 - springerlink.com
... is initiated in Sertoli cell precursors shortly after the activa- tion of Sry and
remains ... Other zinc finger proteins related to GLI such as YY1 in humans and ...
Web Search
ORIGINAL ARTICLE Molecular characterization and chromosomal mapping of porcine adipose … - Full text - MIT Libraries
TH Kim, BH Choi, GW Chang, KT Lee, HY Lee, JH Lee, … - Journal of Animal Breeding and Genetics, 2005 - blackwell-synergy.com
... The transcriptional factors include c-Ets-1, CdxA, SRY, MZF1, C/EBPb, HNF-3b,
HFH-1, 2, RORalp, SP1, YY1, Egr-2 and SF (data not shown). ...
Web Search
Antisense promoter of human L1 retrotransposon drives transcription of adjacent cellular genes - Full text - MIT Libraries
M Speek - Mol. Cell. Biol, 2001 - mcb.asm.org
... However, because of its ubiquitous nature, it is unlikely that YY1 is responsible ...
Several such factors belonging to the testis-determining factor SRY or SOX ...
Cited by 36 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Environmental factors affecting transcription of the human L 1 retrotransposon. I. Steroid hormone- … - Full text - MIT Libraries
JF Morales, ET Snow, JP Murnane - Mutagenesis, 2002 - mutage.oupjournals.org
... al., 1992 ; Mathias and Scott, 1993 ; Yang et al., 1998 ), including transcription
factors YY1 (Becker et al., 1993 ; Kurose et al., 1995 ) and SRY (Tchenio et ...
Cited by 3 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - csa.com - all 6 versions »
BMC Genomics - Full text - MIT Libraries
J Besco, A Frostholm, MC Popesco, AHM Burghes, A … - BMC Genomics, 2001 - biomedcentral.com
Page 1. ...
View as HTML - Web Search - dx.doi.org - pubmedcentral.nih.gov - bmc.ub.uni-potsdam.de - all 9 versions »
REGULATION OF MILK PROTEIN GENE EXPRESSION - Full text - MIT Libraries
JM Rosen, SL Wyszomierski, D Hadsell - Annual Review of Nutrition, 1999 - nutr.annualreviews.org
... 119). YY1 and the Milk Box Region. ... 139). The downstream site in this region
of the -casein promoter interacts with YY1 (86, 118). ...
Cited by 42 - Web Search - bcm.edu - public.bcm.tmc.edu - ncbi.nlm.nih.gov - all 6 versions »
Insights into the multistep transformation of MGUS to myeloma using microarray expression analysis - Full text - MIT Libraries
FE Davies, AM Dring, C Li, AC Rawstron, MA Shammas … - Blood, 2003 - bloodjournal.org
... 2.82), a regulator of chromatin structure during transcription, which associates
with YY1. ... L14 (RPL14) (+2.56), a component of the 60S subunit, and SRY box 22 ...
Cited by 15 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 8 versions »
XISTential wanderings: The role of XIST RNA in X-chromosome inactivation - Full text - MIT Libraries
SC Spusta, MA Goldman - Current Science, 1999 - ias.ac.in
... of XIST expression interestingly overlaps that of the testis determining gene, Sry. ...
elements bind to common transcription factors such as SP1, YY1, and TBP. ...
Cited by 1 - Cached - Web Search
Highly conserved proximal promoter element harboring paired Sox9-binding sites contributes to the … - Full text - MIT Libraries
O Rentsendorj, A Nagy, I Sinko, A Daraba, E Barta, … - Biochem J, 2005 - biochemj.org
... mobility-group (HMG) box DNA-binding domain highly similar to that of Sry,
a mammalian testis-determining factor [10- 11]. HMG box ...
View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov
Molecular characterization and chromosomal mapping of porcine adipose differentiation-related …
TH Kim, BH Choi, GW Chang, KT Lee, HY Lee, JH Lee, … - ingentaconnect.com
... The transcriptional factors include c-Ets-1, CdxA, SRY, MZF1, C/EBPb, HNF-3b,
HFH-1, 2, RORalp, SP1, YY1, Egr-2 and SF (data not shown). ...
Web Search
INSIGHTS INTO THE MULTISTEP TRANSFORMATION OF MGUS TO MYELOMA USING MICROARRAY EXPRESSION ANALYSIS
KC Anderson, AF Building - bloodjournal.org
... transcription which associates with YY1. Transition of MGUS to MM ... protein L14,
RPL14 (+2.56), a component of the 60S subunit; and SRY box 22, ...
Web Search
| |
©2005 Google